Incidental Mutations

61 incidental mutations are currently displayed, and affect 61 genes.
6 are Possibly Damaging.
17 are Probably Damaging.
29 are Probably Benign.
7 are Probably Null.
1 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 61 of 61] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 454338 UTSW Adarb1 1.000 R5869 G1 211 Y 10 77325616 T C intron Het probably benign 0.090 phenotype 02/10/2017
2 454350 UTSW Arsk 0.000 R5869 G1 220 Y 13 76091784 E100G T C missense Het probably benign 0.292 0.103 phenotype 02/10/2017
3 454337 UTSW Ascc3 0.966 R5869 G1 225 Y 10 50842183 R1991* C T nonsense Het probably null 0.976 phenotype 02/10/2017
4 454345 UTSW Aspscr1 0.000 R5869 G1 225 Y 11 120688920 I31T T C missense Het possibly damaging 0.548 0.179 phenotype 02/10/2017
5 454322 UTSW Asz1 0.241 R5869 G1 225 Y 6 18074940 T C unclassified Het probably benign phenotype 02/10/2017
6 454347 UTSW Calm5 0.136 R5869 G1 225 Y 13 3854321 T A splice site Het probably benign 0.090 02/10/2017
7 454330 UTSW Car5a 0.183 R5869 G1 225 Y 8 121916380 T295I G A missense Het probably benign 0.000 0.090 phenotype 02/10/2017
8 454325 UTSW Ccdc174 1.000 R5869 G1 225 Y 6 91885418 T A utr 3 prime Het probably benign phenotype 02/10/2017
9 454315 UTSW Celsr2 0.000 R5869 G1 182 Y 3 108413909 A529V G A missense Het probably damaging 1.000 0.524 phenotype 02/10/2017
10 454361 UTSW Cep192 0.000 R5869 G1 225 Y 18 67815864 D252G A G missense Het probably benign 0.006 0.090 02/10/2017
11 454318 UTSW Clcnka 0.000 R5869 G1 209 Y 4 141394965 F217L A G missense Het probably benign 0.084 0.118 phenotype 02/10/2017
12 501956 UTSW Cnot3 1.000 R5869 G1 163 Y 7 3644930 A T unclassified Het probably benign phenotype 01/31/2018
13 501955 UTSW Coro1c 0.000 R5869 G1 47 Y 5 113850846 A G intron Het probably benign phenotype 01/31/2018
14 454311 UTSW Cstf3 0.963 R5869 G1 225 Y 2 104659240 A G splice site Het probably null 0.976 phenotype 02/10/2017
15 454348 UTSW Dcdc2a 0.390 R5869 G1 202 Y 13 25107730 P233S C T missense Het probably benign 0.047 0.060 phenotype 02/10/2017
16 454321 UTSW Ddx55 1.000 R5869 G1 225 Y 5 124568682 T581A A G missense Het probably benign 0.000 0.059 phenotype 02/10/2017
17 454308 UTSW Exo1 0.492 R5869 G1 225 Y 1 175901283 S638P T C missense Het possibly damaging 0.592 0.179 phenotype 02/10/2017
18 454304 UTSW Fam135a 0.159 R5869 G1 225 Y 1 24029430 E616G T C missense Het possibly damaging 0.532 0.179 02/10/2017
19 501958 UTSW Fignl2 0.151 R5869 G1 28 Y 15 101053280 S374G T C missense Het unknown 0.087 01/31/2018
20 454339 UTSW Gm4799 0.862 R5869 G1 114 Y 10 82954449 A T exon Het noncoding transcript 0.099 02/10/2017
21 454320 UTSW Hectd4 0.914 R5869 G1 225 Y 5 121343225 T C critical splice donor site 2 bp Het probably null 0.959 02/10/2017
22 454346 UTSW Ighv1-76 0.182 R5869 G1 225 Y 12 115848038 E65G T C missense Het probably damaging 0.990 0.647 02/10/2017
23 454331 UTSW Igsf9b 0.643 R5869 G1 225 Y 9 27323235 H465Q C A missense Het probably benign 0.444 0.065 02/10/2017
24 454335 UTSW Itga9 1.000 R5869 G1 225 Y 9 118663889 D284G A G missense Het probably damaging 0.996 0.294 phenotype 02/10/2017
25 454326 UTSW Itpr1 0.748 R5869 G1 225 Y 6 108473529 S1940P T C missense Het probably benign 0.300 0.090 phenotype 02/10/2017
26 454313 UTSW Kcnb1 0.000 R5869 G1 149 Y 2 167188071 S185P A G missense Het probably benign 0.010 0.844 phenotype 02/10/2017
27 454360 UTSW Kif20a 1.000 R5869 G1 225 Y 18 34632415 A822T G A missense Het probably benign 0.007 0.090 02/10/2017
28 454355 UTSW Krt1 0.477 R5869 G1 225 Y 15 101850131 F199L A T missense Het probably damaging 1.000 0.544 phenotype 02/10/2017
29 454359 UTSW Lpin2 0.358 R5869 G1 225 Y 17 71232276 A G unclassified Het probably benign 0.090 phenotype 02/10/2017
30 454309 UTSW Lrp1b 0.000 R5869 G1 225 Y 2 41004603 D2204E A C missense Het probably damaging 0.977 0.647 phenotype 02/10/2017
31 454351 UTSW Mier3 0.775 R5869 G1 225 Y 13 111714850 N427K T A missense Het probably damaging 0.999 0.182 02/10/2017
32 490493 UTSW Mmp12 0.106 R5869 G1 122 N 9 7348446 GTAATAATAATAATAATAAT GTAATAATAATAATAAT intron Het probably benign phenotype 10/20/2017
33 490492 UTSW Mroh3 0.063 R5869 G1 225 Y 1 136186123 M643L T A missense Het probably benign 0.000 0.090 10/20/2017
34 454356 UTSW Myh11 1.000 R5869 G1 225 Y 16 14230800 S548P A G missense Het probably damaging 0.999 0.914 phenotype 02/10/2017
35 454324 UTSW Nat8f6 0.418 R5869 G1 225 Y 6 85808523 L215V A C missense Het possibly damaging 0.514 0.179 02/10/2017
36 454341 UTSW Nlrp3 0.063 R5869 G1 225 Y 11 59548134 R179Q G A missense Het probably damaging 1.000 0.647 phenotype 02/10/2017
37 454342 UTSW Nup88 0.964 R5869 G1 225 Y 11 70969671 E94G T C missense Het probably benign 0.009 0.072 phenotype 02/10/2017
38 454332 UTSW Pias1 0.958 R5869 G1 225 Y 9 62912766 D306E A T missense Het probably benign 0.062 0.072 phenotype 02/10/2017
39 454354 UTSW Pick1 0.633 R5869 G1 223 Y 15 79248895 D385G A G missense Het probably benign 0.018 0.090 phenotype 02/10/2017
40 501959 UTSW Pitx3 0.000 R5869 G1 225 Y 19 46137296 A T intron Het probably benign 0.090 phenotype 01/31/2018
41 454316 UTSW Plpp3 1.000 R5869 G1 219 Y 4 105194962 T A critical splice donor site 2 bp Het probably null 0.949 phenotype 02/10/2017
42 454363 UTSW Prlhr 0.074 R5869 G1 180 Y 19 60467621 R169L C A missense Het probably damaging 0.961 0.445 phenotype 02/10/2017
43 454317 UTSW Ptprf 0.689 R5869 G1 225 Y 4 118210382 M1872R A C missense Het probably damaging 1.000 0.918 phenotype 02/10/2017
44 454327 UTSW Ptprh 0.000 R5869 G1 225 Y 7 4601940 D35G T C missense Het probably benign 0.001 0.125 phenotype 02/10/2017
45 454340 UTSW Rnf130 0.185 R5869 G1 225 Y 11 50085815 A G splice site 3 bp Het probably null 0.976 phenotype 02/10/2017
46 454352 UTSW Rnf17 0.491 R5869 G1 147 Y 14 56505988 E1337A A C missense Het possibly damaging 0.936 0.179 phenotype 02/10/2017
47 490494 UTSW Sdk2 0.085 R5869 G1 225 Y 11 113851882 Y734H A G missense Het probably damaging 0.962 0.539 phenotype 10/20/2017
48 454344 UTSW Slc25a10 0.000 R5869 G1 195 Y 11 120498117 T269I C T missense Het probably damaging 0.977 0.365 phenotype 02/10/2017
49 454312 UTSW Slc4a11 0.198 R5869 G1 140 Y 2 130684459 V855G A C missense Het probably benign 0.041 0.094 phenotype 02/10/2017
50 501957 UTSW Slc5a5 0.000 R5869 G1 32 Y 8 70892330 R111L C A missense Het probably damaging 0.999 0.492 phenotype 01/31/2018
51 454314 UTSW Spg20 0.209 R5869 G1 225 Y 3 55135510 M616L A T missense Het probably benign 0.005 0.062 phenotype 02/10/2017
52 454323 UTSW Tmem229a 0.060 R5869 G1 225 N 6 24954687 D356G T C missense Het probably damaging 1.000 02/10/2017
53 454357 UTSW Tmem30c 0.058 R5869 G1 225 Y 16 57266562 S293P A G missense Het probably damaging 0.987 0.647 02/10/2017
54 454319 UTSW Tnfrsf14 0.054 R5869 G1 167 Y 4 154926598 C A critical splice donor site 1 bp Het probably null 0.949 phenotype 02/10/2017
55 454353 UTSW Tnfrsf19 0.000 R5869 G1 225 Y 14 60971178 R298H C T missense Het possibly damaging 0.699 0.179 phenotype 02/10/2017
56 454336 UTSW Ttc21a 0.335 R5869 G1 225 Y 9 119958792 K809E A G missense Het probably benign 0.032 0.153 02/10/2017
57 454310 UTSW Ttn 1.000 R5869 G1 225 Y 2 76750209 P23447S G A missense Het probably damaging 1.000 0.194 phenotype 02/10/2017
58 454307 UTSW Uap1 0.639 R5869 G1 225 Y 1 170151138 T A critical splice acceptor site Het probably null 0.951 02/10/2017
59 454333 UTSW Wdr82 0.957 R5869 G1 225 Y 9 106185304 Q252R A G missense Het probably benign 0.003 0.065 phenotype 02/10/2017
60 454358 UTSW Zfp523 0.345 R5869 G1 192 Y 17 28194993 I34T T C missense Het probably benign 0.366 0.098 02/10/2017
61 454349 UTSW Zfp808 0.080 R5869 G1 225 Y 13 62171255 H99Q T A missense Het probably damaging 1.000 0.647 02/10/2017
[records 1 to 61 of 61]