Incidental Mutations

87 incidental mutations are currently displayed, and affect 87 genes.
15 are Possibly Damaging.
35 are Probably Damaging.
31 are Probably Benign.
5 are Probably Null.
1 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 87 of 87] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 456485 UTSW 1810062G17Rik 0.124 R5905 G1 225 N 3 36479569 T A critical splice donor site 2 bp Het probably null 0.976 02/15/2017
2 456527 UTSW Acat1 0.345 R5905 G1 225 N 9 53592066 Y158N A T missense Het probably damaging 1.000 0.967 phenotype 02/15/2017
3 456493 UTSW Adamtsl1 0.152 R5905 G1 191 N 4 86342324 A924E C A missense Het probably damaging 1.000 0.595 phenotype 02/15/2017
4 456491 UTSW Alad 1.000 R5905 G1 202 N 4 62510122 T305K G T missense Het probably benign 0.059 0.090 phenotype 02/15/2017
5 456529 UTSW Als2cl 0.113 R5905 G1 144 N 9 110898084 R906L G T missense Het probably damaging 1.000 02/15/2017
6 456535 UTSW Ap3d1 0.925 R5905 G1 141 N 10 80722927 N281S T C missense Het possibly damaging 0.495 0.766 phenotype 02/15/2017
7 456553 UTSW Arf4 1.000 R5905 G1 219 N 14 26653924 T113A A G missense Het probably benign 0.028 phenotype 02/15/2017
8 456558 UTSW Arhgap8 0.000 R5905 G1 225 N 15 84741977 K84N A T missense Het possibly damaging 0.531 02/15/2017
9 456563 UTSW Asah2 0.251 R5905 G1 225 N 19 32016514 D438G T C missense Het probably damaging 1.000 0.927 phenotype 02/15/2017
10 456495 UTSW Cachd1 0.266 R5905 G1 225 N 4 100983556 N905K C A missense Het probably damaging 0.986 0.409 02/15/2017
11 456542 UTSW Catsperb 0.075 R5905 G1 225 N 12 101602700 M877K T A missense Het possibly damaging 0.688 02/15/2017
12 456500 UTSW Cc2d2a 0.898 R5905 G1 225 N 5 43712426 M890L A T missense Het probably benign 0.000 phenotype 02/15/2017
13 456551 UTSW Cd180 0.000 R5905 G1 225 N 13 102706033 H529L A T missense Het possibly damaging 0.928 phenotype 02/15/2017
14 456533 UTSW Cdh23 0.675 R5905 G1 125 N 10 60534535 D160E G T missense Het probably damaging 0.979 0.778 phenotype 02/15/2017
15 456489 UTSW Chd7 0.955 R5905 G1 225 N 4 8840553 N1440K C A missense Het possibly damaging 0.909 phenotype 02/15/2017
16 456492 UTSW Cntln 0.245 R5905 G1 225 N 4 84971173 S298T T A missense Het probably benign 0.030 0.090 02/15/2017
17 501641 UTSW Dmap1 1.000 R5905 G1 225 N 4 117676766 T132K G T missense Het probably benign 0.002 phenotype 12/01/2017
18 456544 UTSW Dnah11 0.592 R5905 G1 225 N 12 117954924 G3424E C T missense Het probably damaging 0.998 phenotype 02/15/2017
19 456557 UTSW Dnah5 0.641 R5905 G1 225 N 15 28387833 M3146K T A missense Het probably damaging 0.999 0.465 phenotype 02/15/2017
20 501642 UTSW Egfr 0.908 R5905 G1 225 N 11 16911494 E1091V A T missense Het probably damaging 0.996 phenotype 12/01/2017
21 456520 UTSW Eps8l2 0.000 R5905 G1 224 N 7 141357833 F422S T C missense Het possibly damaging 0.892 0.831 phenotype 02/15/2017
22 456550 UTSW F2r 0.452 R5905 G1 225 N 13 95604613 V138A A G missense Het possibly damaging 0.843 phenotype 02/15/2017
23 456496 UTSW Faf1 1.000 R5905 G1 225 N 4 109890929 M477K T A missense Het probably benign 0.029 phenotype 02/15/2017
24 456552 UTSW Fam149b 0.197 R5905 G1 225 N 14 20359910 T235M C T missense Het probably benign 0.301 02/15/2017
25 456513 UTSW Fan1 0.000 R5905 G1 225 N 7 64353651 A808S C A missense Het probably benign 0.003 phenotype 02/15/2017
26 501643 UTSW Fbxl20 0.302 R5905 G1 225 N 11 98115445 I38T A G missense Het probably damaging 1.000 phenotype 12/01/2017
27 456480 UTSW Fnbp4 0.891 R5905 G1 225 N 2 90751134 T177K C A missense Het probably benign 0.294 0.090 02/15/2017
28 456540 UTSW Gm884 0.142 R5905 G1 225 N 11 103614255 S2296T A T missense Het probably damaging 0.984 0.647 02/15/2017
29 456474 UTSW Gm9747 0.197 R5905 G1 225 N 1 82234298 T C utr 3 prime Het probably benign 02/15/2017
30 456536 UTSW Grip1 1.000 R5905 G1 225 N 10 119985492 D354G A G missense Het probably benign 0.016 phenotype 02/15/2017
31 456498 UTSW Grk4 0.113 R5905 G1 225 N 5 34711730 Y189S A C missense Het probably damaging 0.999 phenotype 02/15/2017
32 501640 UTSW Hax1 0.170 R5905 G1 217 N 3 89997940 GTCATCATCATCATCATC GTCATCATCATCATCATCATC small insertion Het probably benign 0.090 phenotype 12/01/2017
33 456499 UTSW Hgfac 0.080 R5905 G1 225 N 5 35042362 N63D A G missense Het probably benign 0.196 phenotype 02/15/2017
34 456534 UTSW Hk1 0.442 R5905 G1 225 N 10 62353058 K25N C A missense Het probably null 0.816 0.976 phenotype 02/15/2017
35 456512 UTSW Hrc 0.000 R5905 G1 225 N 7 45336234 G270S G A missense Het probably damaging 0.985 phenotype 02/15/2017
36 456545 UTSW Inhba 1.000 R5905 G1 225 N 13 16017308 W5R T A missense Het probably benign 0.048 phenotype 02/15/2017
37 501644 UTSW Lipm 0.365 R5905 G1 225 N 19 34111911 S90P T C missense Het probably benign 0.000 12/01/2017
38 456528 UTSW Lman1l 0.000 R5905 G1 186 N 9 57608263 I443T A G missense Het probably damaging 0.996 0.268 phenotype 02/15/2017
39 456506 UTSW Lmod3 0.110 R5905 G1 225 N 6 97247614 E415D T A missense Het probably damaging 0.996 phenotype 02/15/2017
40 456556 UTSW Lrrc63 0.094 R5905 G1 225 N 14 75086174 S537P A G missense Het possibly damaging 0.921 0.259 02/15/2017
41 456487 UTSW Map9 0.224 R5905 G1 225 N 3 82380248 T A critical splice donor site 2 bp Het probably null 0.949 phenotype 02/15/2017
42 456559 UTSW Marf1 0.153 R5905 G1 225 N 16 14127249 Q1252L T A missense Het probably damaging 0.993 phenotype 02/15/2017
43 456484 UTSW Mc3r 0.165 R5905 G1 225 N 2 172249209 D117V A T missense Het probably damaging 0.997 0.755 phenotype 02/15/2017
44 456503 UTSW Mepce 1.000 R5905 G1 158 N 5 137784720 V448A A G missense Het possibly damaging 0.780 02/15/2017
45 456530 UTSW Mical1 0.128 R5905 G1 225 N 10 41486877 M973L A T missense Het probably benign 0.001 0.090 phenotype 02/15/2017
46 456519 UTSW Mmp21 0.064 R5905 G1 225 N 7 133678714 T176A T C missense Het probably benign 0.170 0.090 phenotype 02/15/2017
47 456476 UTSW Nacc2 0.000 R5905 G1 92 N 2 26061578 V415A A G missense Het probably damaging 1.000 0.429 02/15/2017
48 456478 UTSW Neb 0.881 R5905 G1 225 N 2 52193231 T1639I G A missense Het probably damaging 0.991 0.275 phenotype 02/15/2017
49 456494 UTSW Nfia 1.000 R5905 G1 225 N 4 98111251 H485R A G missense Het possibly damaging 0.822 0.071 phenotype 02/15/2017
50 456511 UTSW Nlrp9a 0.071 R5905 G1 225 N 7 26558337 T460I C T missense Het probably benign 0.018 0.090 02/15/2017
51 456479 UTSW Olfr1079 0.072 R5905 G1 225 N 2 86538769 I49F T A missense Het possibly damaging 0.908 0.179 phenotype 02/15/2017
52 456475 UTSW Olfr12 0.083 R5905 G1 225 N 1 92620142 C79S T A missense Het possibly damaging 0.493 phenotype 02/15/2017
53 456514 UTSW Olfr625-ps1 0.078 R5905 G1 225 N 7 103683574 N285K T A missense Het probably damaging 0.998 02/15/2017
54 456515 UTSW Olfr689 0.054 R5905 G1 225 N 7 105314951 Y316H T C missense Het probably benign 0.000 phenotype 02/15/2017
55 456537 UTSW Olfr763 0.144 R5905 G1 177 N 10 129011287 M1L A T start codon destroyed Het probably benign 0.006 phenotype 02/15/2017
56 456526 UTSW Olfr938 0.062 R5905 G1 225 N 9 39078083 I221F T A missense Het probably damaging 0.998 0.647 phenotype 02/15/2017
57 456517 UTSW Otoa 0.000 R5905 G1 225 N 7 121094601 L68Q T A missense Het probably damaging 1.000 phenotype 02/15/2017
58 456497 UTSW Pclo 0.000 R5905 G1 225 N 5 14680385 A T unclassified Het probably benign phenotype 02/15/2017
59 456483 UTSW Pcsk2 0.270 R5905 G1 153 N 2 143749140 Y186N T A missense Het probably damaging 0.982 phenotype 02/15/2017
60 456560 UTSW Pigz 0.000 R5905 G1 225 N 16 31945428 T435A A G missense Het probably benign 0.257 phenotype 02/15/2017
61 456562 UTSW Pja2 0.000 R5905 G1 225 N 17 64309090 D270G T C missense Het probably benign 0.259 0.090 02/15/2017
62 456521 UTSW Polb 1.000 R5905 G1 225 N 8 22639995 S187* G T nonsense Het probably null 0.976 phenotype 02/15/2017
63 456532 UTSW Popdc3 0.000 R5905 G1 225 N 10 45317919 D272G A G missense Het probably benign 0.000 0.090 phenotype 02/15/2017
64 456518 UTSW Prss36 0.000 R5905 G1 225 N 7 127933572 D716G T C missense Het probably benign 0.262 02/15/2017
65 456543 UTSW Rapgef5 0.000 R5905 G1 225 N 12 117748426 D547E T A missense Het probably damaging 0.998 phenotype 02/15/2017
66 501639 UTSW Slc4a11 0.177 R5905 G1 152 N 2 130685052 I719F T A missense Het probably damaging 0.998 phenotype 12/01/2017
67 456531 UTSW Smpd2 0.000 R5905 G1 225 N 10 41489348 W51R A G missense Het probably damaging 1.000 0.949 phenotype 02/15/2017
68 456482 UTSW Snrpb 0.953 R5905 G1 113 N 2 130179276 T A start gained Het probably benign phenotype 02/15/2017
69 456541 UTSW Sox9 1.000 R5905 G1 193 N 11 112783820 E148G A G missense Het probably damaging 0.996 phenotype 02/15/2017
70 456477 UTSW Strbp 0.384 R5905 G1 225 N 2 37625255 T253I G A missense Het probably damaging 1.000 0.839 phenotype 02/15/2017
71 456502 UTSW Sult1d1 0.061 R5905 G1 225 N 5 87559826 M145K A T missense Het probably damaging 1.000 0.647 phenotype 02/15/2017
72 456516 UTSW Syt17 0.000 R5905 G1 225 N 7 118436918 D74G T C missense Het probably benign 0.103 02/15/2017
73 456525 UTSW Taf5l 0.956 R5905 G1 225 N 8 124002975 A C critical splice donor site 2 bp Het probably null 0.975 phenotype 02/15/2017
74 456508 UTSW Tas2r131 0.000 R5905 G1 225 N 6 132957676 I57L T G missense Het probably benign 0.019 0.090 02/15/2017
75 456524 UTSW Tcf25 0.000 R5905 G1 225 N 8 123381437 N77S A G missense Het possibly damaging 0.778 0.087 phenotype 02/15/2017
76 456554 UTSW Tmem253 0.069 R5905 G1 225 N 14 52017811 T57A A G missense Het possibly damaging 0.732 0.179 02/15/2017
77 456504 UTSW Trrap 1.000 R5905 G1 225 N 5 144849920 K3170R A G missense Het possibly damaging 0.946 phenotype 02/15/2017
78 456549 UTSW Tspan17 0.000 R5905 G1 225 N 13 54793298 N130S A G missense Het probably damaging 0.980 0.150 phenotype 02/15/2017
79 456547 UTSW Vmn1r216 0.195 R5905 G1 225 N 13 23099197 L17F C T missense Het probably damaging 0.999 02/15/2017
80 456486 UTSW Vmn2r3 0.000 R5905 G1 225 N 3 64275277 T334S T A missense Het probably benign 0.193 0.300 02/15/2017
81 456548 UTSW Wnk2 0.464 R5905 G1 218 N 13 49076345 A901E G T missense Het probably damaging 0.985 0.647 phenotype 02/15/2017
82 456505 UTSW Zc3hav1 0.103 R5905 G1 225 N 6 38307340 T947A T C missense Het probably benign 0.029 0.071 phenotype 02/15/2017
83 456523 UTSW Zfhx3 0.934 R5905 G1 225 N 8 108793503 P419L C T missense Het probably damaging 0.999 0.225 phenotype 02/15/2017
84 456490 UTSW Zfp292 0.658 R5905 G1 225 N 4 34819549 S258P A G missense Het probably damaging 1.000 0.232 02/15/2017
85 456538 UTSW Zfp354c 0.077 R5905 G1 225 N 11 50815426 Y274C T C missense Het probably damaging 1.000 02/15/2017
86 456539 UTSW Zfp652 0.825 R5905 G1 225 N 11 95749863 A205T G A missense Het probably benign 0.000 02/15/2017
87 456522 UTSW Zfp964 0.070 R5905 G1 225 N 8 69663913 T388A A G missense Het unknown 0.087 02/15/2017
[records 1 to 87 of 87]