Incidental Mutations

73 incidental mutations are currently displayed, and affect 73 genes.
12 are Possibly Damaging.
29 are Probably Damaging.
19 are Probably Benign.
11 are Probably Null.
4 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 73 of 73] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 480155 UTSW 1810062G17Rik 0.138 R6028 G1 225.01 Y 3 36479569 T A critical splice donor site 2 bp Het probably null 0.976 06/26/2017
2 480180 UTSW Acat1 0.394 R6028 G1 225.01 Y 9 53592066 Y158N A T missense Het probably damaging 1.000 0.967 phenotype 06/26/2017
3 480162 UTSW Adamtsl1 0.220 R6028 G1 225.01 Y 4 86342324 A924E C A missense Het probably damaging 1.000 0.595 phenotype 06/26/2017
4 480201 UTSW Adck1 0.000 R6028 G1 95.01 Y 12 88402132 M127L A T missense Het probably benign 0.000 0.061 06/26/2017
5 480214 UTSW Afg3l2 1.000 R6028 G1 225.01 Y 18 67421259 L458M G T missense Het probably damaging 1.000 0.387 phenotype 06/26/2017
6 480160 UTSW Alad 1.000 R6028 G1 225.01 Y 4 62510122 T305K G T missense Het probably benign 0.059 0.090 phenotype 06/26/2017
7 480210 UTSW Ankrd33 0.083 R6028 G1 203.01 Y 15 101119072 F65S T C missense Het probably damaging 1.000 06/26/2017
8 480188 UTSW Ap3d1 0.939 R6028 G1 225.01 Y 10 80722927 N281S T C missense Het possibly damaging 0.495 0.766 phenotype 06/26/2017
9 480147 UTSW Arhgap30 0.000 R6028 G1 192.01 Y 1 171408320 D754G A G missense Het probably benign 0.000 0.090 06/26/2017
10 480215 UTSW Asah2 0.341 R6028 G1 225.01 Y 19 32016514 D438G T C missense Het probably damaging 1.000 0.927 phenotype 06/26/2017
11 480164 UTSW Cachd1 0.184 R6028 G1 225.01 Y 4 100983556 N905K C A missense Het probably damaging 0.986 0.409 06/26/2017
12 480186 UTSW Cdh23 0.630 R6028 G1 177.01 Y 10 60534535 D160E G T missense Het probably damaging 0.979 0.778 phenotype 06/26/2017
13 480161 UTSW Cntln 0.265 R6028 G1 225.01 Y 4 84971173 S298T T A missense Het probably benign 0.030 0.090 06/26/2017
14 480208 UTSW Dnah5 0.802 R6028 G1 225.01 Y 15 28387833 M3146K T A missense Het probably damaging 0.999 0.465 phenotype 06/26/2017
15 480193 UTSW Doc2b 0.075 R6028 G1 225.01 Y 11 75772586 A347S C A missense Het probably benign 0.041 0.065 phenotype 06/26/2017
16 480172 UTSW Eps8l2 0.000 R6028 G1 225.01 Y 7 141357833 F422S T C missense Het possibly damaging 0.892 0.831 phenotype 06/26/2017
17 480204 UTSW Esm1 0.093 R6028 G1 225.01 Y 13 113216667 N161S A G missense Het possibly damaging 0.735 0.101 phenotype 06/26/2017
18 480192 UTSW Fbxw10 0.069 R6028 G1 225.01 Y 11 62873519 Q671* C T nonsense Het probably null 0.976 phenotype 06/26/2017
19 480152 UTSW Fnbp4 0.881 R6028 G1 225.01 Y 2 90751134 T177K C A missense Het probably benign 0.294 0.090 06/26/2017
20 480196 UTSW Gm11639 0.115 R6028 G1 225.01 Y 11 104769655 T C critical splice donor site 2 bp Het probably null 0.976 06/26/2017
21 480200 UTSW Gm6803 R6028 G1 225.01 N 12 88018361 D137E A T missense Het possibly damaging 0.705 06/26/2017
22 480205 UTSW Gpr137c 0.086 R6028 G1 225.01 Y 14 45277481 Q266K C A missense Het probably damaging 0.962 0.086 06/26/2017
23 480158 UTSW Hax1 0.231 R6028 G1 217.47 Y 3 89997940 GTCATCATCATCATCATC GTCATCATCATCATCATCATC small insertion Het probably benign 0.090 phenotype 06/26/2017
24 480187 UTSW Hk1 0.404 R6028 G1 225.01 Y 10 62353058 K25N C A missense Het probably null 0.816 0.976 phenotype 06/26/2017
25 480197 UTSW Klhl29 0.155 R6028 G1 225.01 Y 12 5090995 Y616* G T nonsense Het probably null 0.976 06/26/2017
26 480181 UTSW Lman1l 0.000 R6028 G1 225.01 Y 9 57608263 I443T A G missense Het probably damaging 0.996 0.268 phenotype 06/26/2017
27 480213 UTSW Lmnb1 1.000 R6028 G1 225.01 Y 18 56743276 Y485* T G nonsense Het probably null 0.976 phenotype 06/26/2017
28 480207 UTSW Lrrc63 0.083 R6028 G1 225.01 Y 14 75086174 S537P A G missense Het possibly damaging 0.921 0.259 06/26/2017
29 480199 UTSW Ltbp2 0.825 R6028 G1 225.01 Y 12 84784852 N1686I T A missense Het probably damaging 1.000 0.610 phenotype 06/26/2017
30 480157 UTSW Map9 0.231 R6028 G1 225.01 Y 3 82380248 T A critical splice donor site 2 bp Het probably null 0.949 phenotype 06/26/2017
31 480145 UTSW Marco 0.064 R6028 G1 225.01 Y 1 120490942 Q194L T A missense Het probably damaging 0.970 0.205 phenotype 06/26/2017
32 480154 UTSW Mc3r 0.150 R6028 G1 225.01 Y 2 172249209 D117V A T missense Het probably damaging 0.997 0.755 phenotype 06/26/2017
33 480211 UTSW Meltf 0.000 R6028 G1 194.01 Y 16 31887476 D259E T A missense Het possibly damaging 0.908 0.620 phenotype 06/26/2017
34 480183 UTSW Mical1 0.117 R6028 G1 225.01 Y 10 41486877 M973L A T missense Het probably benign 0.001 0.090 phenotype 06/26/2017
35 480171 UTSW Mmp21 0.069 R6028 G1 225.01 Y 7 133678714 T176A T C missense Het probably benign 0.170 0.090 phenotype 06/26/2017
36 482094 UTSW Mterf1b 0.371 R6028 G1 95.01 Y 5 4197666 T A splice site 15 bp Het probably null 0.976 phenotype 06/27/2017
37 480178 UTSW Muc16 0.140 R6028 G1 225.01 Y 9 18657176 S1349F G A missense Het unknown phenotype 06/26/2017
38 480148 UTSW Nacc2 0.000 R6028 G1 225.01 Y 2 26061578 V415A A G missense Het probably damaging 1.000 0.429 06/26/2017
39 480144 UTSW Ncl 0.961 R6028 G1 225.01 Y 1 86356133 V322A A G missense Het probably benign 0.003 0.090 phenotype 06/26/2017
40 480150 UTSW Neb 0.894 R6028 G1 225.01 Y 2 52193231 T1639I G A missense Het probably damaging 0.991 0.275 phenotype 06/26/2017
41 480163 UTSW Nfia 1.000 R6028 G1 225.01 Y 4 98111251 H485R A G missense Het possibly damaging 0.822 0.071 phenotype 06/26/2017
42 480170 UTSW Nlrp9a 0.058 R6028 G1 225.01 Y 7 26558337 T460I C T missense Het probably benign 0.018 0.090 06/26/2017
43 480151 UTSW Olfr1079 0.060 R6028 G1 225.01 Y 2 86538769 I49F T A missense Het possibly damaging 0.908 0.179 phenotype 06/26/2017
44 480179 UTSW Olfr938 0.057 R6028 G1 225.01 Y 9 39078083 I221F T A missense Het probably damaging 0.998 0.647 phenotype 06/26/2017
45 480153 UTSW Patl2 0.107 R6028 G1 225.01 Y 2 122126137 Q158L T A missense Het possibly damaging 0.759 0.127 06/26/2017
46 480212 UTSW Pja2 0.000 R6028 G1 225.01 Y 17 64309090 D270G T C missense Het probably benign 0.259 0.090 06/26/2017
47 480191 UTSW Pkd1l1 1.000 R6028 G1 225.01 Y 11 8836267 H1929R T C missense Het probably benign 0.061 0.090 phenotype 06/26/2017
48 480195 UTSW Plekhh3 0.102 R6028 G1 108.01 Y 11 101166570 M287K A T missense Het probably damaging 0.996 0.366 06/26/2017
49 480173 UTSW Polb 1.000 R6028 G1 225.01 Y 8 22639995 S187* G T nonsense Het probably null 0.976 phenotype 06/26/2017
50 480185 UTSW Popdc3 0.000 R6028 G1 225.01 Y 10 45317919 D272G A G missense Het probably benign 0.000 0.090 phenotype 06/26/2017
51 480198 UTSW Prkar2b 0.537 R6028 G1 225.01 Y 12 31993758 D121E A T missense Het possibly damaging 0.496 0.070 phenotype 06/26/2017
52 480194 UTSW Psmd3 0.950 R6028 G1 225.01 Y 11 98685665 L131Q T A missense Het probably damaging 0.994 0.903 phenotype 06/26/2017
53 480168 UTSW Ptcd3 1.000 R6028 G1 225.01 Y 6 71898408 C197S A T missense Het probably damaging 1.000 0.587 06/26/2017
54 480165 UTSW Ptprf 0.713 R6028 G1 225.01 Y 4 118213629 V1391D A T missense Het probably benign 0.009 0.339 phenotype 06/26/2017
55 480190 UTSW Purb 0.340 R6028 G1 225.01 Y 11 6475150 F246S A G missense Het probably damaging 0.995 0.955 phenotype 06/26/2017
56 480146 UTSW Rgs8 0.118 R6028 G1 225.01 Y 1 153690988 T95N C A missense Het probably damaging 0.998 0.133 phenotype 06/26/2017
57 480209 UTSW Slc2a13 0.000 R6028 G1 225.01 Y 15 91276116 N545S T C missense Het probably damaging 0.998 0.350 06/26/2017
58 480184 UTSW Smpd2 0.000 R6028 G1 225.01 Y 10 41489348 W51R A G missense Het probably damaging 1.000 0.949 phenotype 06/26/2017
59 480189 UTSW Srgap1 0.229 R6028 G1 225.01 Y 10 121828730 Q490R T C missense Het probably null 0.000 0.498 phenotype 06/26/2017
60 480149 UTSW Strbp 0.427 R6028 G1 225.01 Y 2 37625255 T253I G A missense Het probably damaging 1.000 0.839 phenotype 06/26/2017
61 480166 UTSW Sult1d1 0.053 R6028 G1 225.01 Y 5 87559826 M145K A T missense Het probably damaging 1.000 0.647 phenotype 06/26/2017
62 480177 UTSW Taf5l 0.965 R6028 G1 225.01 Y 8 124002975 A C critical splice donor site 2 bp Het probably null 0.975 phenotype 06/26/2017
63 480169 UTSW Tas2r131 0.000 R6028 G1 225.01 Y 6 132957676 I57L T G missense Het probably benign 0.019 0.090 06/26/2017
64 480176 UTSW Tcf25 0.000 R6028 G1 225.01 Y 8 123381437 N77S A G missense Het possibly damaging 0.778 0.087 phenotype 06/26/2017
65 480206 UTSW Tmem253 0.076 R6028 G1 225.01 Y 14 52017811 T57A A G missense Het possibly damaging 0.732 0.179 06/26/2017
66 480203 UTSW Tspan17 0.000 R6028 G1 225.01 Y 13 54793298 N130S A G missense Het probably damaging 0.980 0.150 phenotype 06/26/2017
67 480182 UTSW Utrn 0.000 R6028 G1 225.01 Y 10 12654716 S2118G T C missense Het probably benign 0.001 0.090 phenotype 06/26/2017
68 480156 UTSW Vmn2r3 0.000 R6028 G1 225.01 Y 3 64275277 T334S T A missense Het probably benign 0.193 0.300 06/26/2017
69 480202 UTSW Wnk2 0.343 R6028 G1 151.01 Y 13 49076345 A901E G T missense Het probably damaging 0.985 0.647 phenotype 06/26/2017
70 480167 UTSW Zc3hav1 0.096 R6028 G1 225.01 Y 6 38307340 T947A T C missense Het probably benign 0.029 0.071 phenotype 06/26/2017
71 480175 UTSW Zfhx3 0.933 R6028 G1 225.01 Y 8 108793503 P419L C T missense Het probably damaging 0.999 0.225 phenotype 06/26/2017
72 480159 UTSW Zfp292 0.636 R6028 G1 225.01 Y 4 34819549 S258P A G missense Het probably damaging 1.000 0.232 06/26/2017
73 480174 UTSW Zfp964 0.079 R6028 G1 225.01 Y 8 69663913 T388A A G missense Het unknown 0.087 06/26/2017
[records 1 to 73 of 73]