Incidental Mutations

63 incidental mutations are currently displayed, and affect 63 genes.
10 are Possibly Damaging.
20 are Probably Damaging.
29 are Probably Benign.
1 are Probably Null.
0 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 63 of 63] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 484332 UTSW 4930562C15Rik 0.205 R6054 G1 225.01 N 16 4835865 S93P T C missense Het unknown 07/14/2017
2 484330 UTSW Adam28 0.136 R6054 G1 225.01 N 14 68642152 N149I T A missense Het probably benign 0.011 phenotype 07/14/2017
3 484324 UTSW Adam4 0.058 R6054 G1 225.01 N 12 81420054 F598V A C missense Het probably damaging 0.991 07/14/2017
4 484290 UTSW Adh5 0.000 R6054 G1 225.01 N 3 138445375 H33R A G missense Het possibly damaging 0.663 phenotype 07/14/2017
5 484323 UTSW Apoh 0.430 R6054 G1 225.01 N 11 108395975 N75S A G missense Het probably damaging 1.000 phenotype 07/14/2017
6 484336 UTSW Arrdc5 0.000 R6054 G1 225.01 N 17 56294420 E235G T C missense Het possibly damaging 0.919 0.127 07/14/2017
7 484309 UTSW Atm 0.881 R6054 G1 202.01 N 9 53459873 D2225G T C missense Het probably damaging 1.000 phenotype 07/14/2017
8 484322 UTSW Atp6v0a1 1.000 R6054 G1 225.01 N 11 101039889 P514L C T missense Het possibly damaging 0.909 phenotype 07/14/2017
9 484328 UTSW Brd9 1.000 R6054 G1 225.01 N 13 73940741 M195K T A missense Het probably damaging 0.999 07/14/2017
10 484306 UTSW Cacna1a 0.920 R6054 G1 225.01 N 8 84556785 S755A T G missense Het probably damaging 0.994 phenotype 07/14/2017
11 484325 UTSW Ccdc85c 0.143 R6054 G1 87.01 N 12 108274769 H122L T A missense Het unknown phenotype 07/14/2017
12 484342 UTSW Ccs 0.324 R6054 G1 225.01 N 19 4825865 D192E A T missense Het probably benign 0.429 phenotype 07/14/2017
13 484308 UTSW Cd3e 0.000 R6054 G1 225.01 N 9 45002161 T92M G A missense Het possibly damaging 0.874 phenotype 07/14/2017
14 484289 UTSW Celsr2 0.000 R6054 G1 225.01 N 3 108406963 F1249L A G missense Het possibly damaging 0.954 phenotype 07/14/2017
15 484291 UTSW Col16a1 0.088 R6054 G1 225.01 N 4 130061722 G A unclassified Het probably benign phenotype 07/14/2017
16 484345 UTSW Col17a1 0.000 R6054 G1 225.01 N 19 47680420 Y122H A G missense Het probably damaging 1.000 phenotype 07/14/2017
17 484297 UTSW Col28a1 0.077 R6054 G1 225.01 N 6 8083748 P570S G A missense Het possibly damaging 0.956 phenotype 07/14/2017
18 484287 UTSW Dchs2 0.395 R6054 G1 225.01 N 3 83346236 I2318L A T missense Het probably benign 0.001 07/14/2017
19 484286 UTSW Dhx35 1.000 R6054 G1 219.01 N 2 158818299 Y184N T A missense Het probably benign 0.005 phenotype 07/14/2017
20 484341 UTSW Dmxl1 0.943 R6054 G1 225.01 N 18 49857386 N297K T G missense Het probably benign 0.003 phenotype 07/14/2017
21 484326 UTSW Dsp 1.000 R6054 G1 225.01 N 13 38167609 G135S G A missense Het probably benign 0.001 phenotype 07/14/2017
22 484335 UTSW Efhb 0.112 R6054 G1 225.01 N 17 53398999 V837I C T missense Het possibly damaging 0.902 07/14/2017
23 484329 UTSW Efs 0.165 R6054 G1 225.01 N 14 54921157 D15N C T missense Het probably damaging 0.999 phenotype 07/14/2017
24 484305 UTSW Fbxl19 0.925 R6054 G1 225.01 N 7 127752509 T314I C T missense Het probably damaging 0.993 phenotype 07/14/2017
25 484321 UTSW Gm11595 0.074 R6054 G1 225.01 N 11 99772648 C69S A T missense Het unknown 07/14/2017
26 484339 UTSW Grxcr2 0.000 R6054 G1 208.01 N 18 41986678 V199A A G missense Het probably benign 0.013 phenotype 07/14/2017
27 484294 UTSW Hadha 1.000 R6054 G1 225.01 N 5 30123684 E468G T C missense Het probably benign 0.002 phenotype 07/14/2017
28 484288 UTSW Hax1 0.203 R6054 G1 217.47 N 3 89997940 GTCATCATCATCATCATC GTCATCATCATCATCATCATC small insertion Het probably benign 0.090 phenotype 07/14/2017
29 484343 UTSW Hps1 0.360 R6054 G1 225.01 N 19 42770778 V125E A T missense Het probably damaging 0.963 phenotype 07/14/2017
30 484333 UTSW Hrg 0.315 R6054 G1 225.01 N 16 22953662 T74S A T missense Het probably benign 0.052 phenotype 07/14/2017
31 484310 UTSW Idh3a 0.955 R6054 G1 130.01 N 9 54586545 T C critical splice donor site Het probably benign phenotype 07/14/2017
32 484299 UTSW Leng8 0.968 R6054 G1 213.01 N 7 4145523 C A unclassified 2392 bp Het probably null 07/14/2017
33 484307 UTSW Maml2 0.000 R6054 G1 133.47 N 9 13621399 TCAGCAGCAGCAGCAGCAGC TCAGCAGCAGCAGCAGC small deletion Het probably benign 07/14/2017
34 484302 UTSW Mctp2 0.195 R6054 G1 129.01 N 7 72259103 H154R T C missense Het probably benign 0.000 07/14/2017
35 484293 UTSW Megf6 0.000 R6054 G1 225.01 N 4 154263179 E777G A G missense Het probably benign 0.058 07/14/2017
36 484344 UTSW Mgea5 1.000 R6054 G1 225.01 N 19 45776132 S190P A G missense Het probably damaging 1.000 phenotype 07/14/2017
37 484292 UTSW Miip 0.084 R6054 G1 225.01 N 4 147865678 S154P A G missense Het probably benign 0.002 phenotype 07/14/2017
38 484319 UTSW Mprip 0.512 R6054 G1 225.01 N 11 59758425 V985A T C missense Het probably benign 0.000 07/14/2017
39 484315 UTSW Nmrk2 0.230 R6054 G1 225.01 N 10 81199634 R158W G A missense Het probably damaging 0.962 phenotype 07/14/2017
40 484295 UTSW Nsd2 0.800 R6054 G1 219.01 N 5 33882161 S180P T C missense Het probably damaging 1.000 phenotype 07/14/2017
41 484318 UTSW Olfr1377 0.082 R6054 G1 225.01 N 11 50984804 M34I G A missense Het probably benign 0.003 phenotype 07/14/2017
42 484303 UTSW Olfr66 0.067 R6054 G1 225.01 N 7 103881826 V139A A G missense Het probably damaging 0.977 phenotype 07/14/2017
43 484334 UTSW Opa1 1.000 R6054 G1 225.01 N 16 29615134 S596A T G missense Het probably damaging 0.998 phenotype 07/14/2017
44 484337 UTSW Pcdha2 0.133 R6054 G1 225.01 N 18 36940804 E496G A G missense Het probably damaging 1.000 phenotype 07/14/2017
45 484338 UTSW Pcdhb5 0.077 R6054 G1 225.01 N 18 37321080 V171G T G missense Het probably damaging 0.984 phenotype 07/14/2017
46 484284 UTSW Pramel6 0.076 R6054 G1 225.01 N 2 87508659 T68A A G missense Het probably benign 0.071 07/14/2017
47 484316 UTSW Ptprq 0.371 R6054 G1 225.01 N 10 107582358 Y1719C T C missense Het probably damaging 1.000 phenotype 07/14/2017
48 484298 UTSW Pzp 0.086 R6054 G1 225.01 N 6 128513764 N412S T C missense Het probably benign 0.025 phenotype 07/14/2017
49 484283 UTSW Rb1cc1 1.000 R6054 G1 225.01 N 1 6249834 R1159L G T missense Het probably benign 0.012 phenotype 07/14/2017
50 484313 UTSW Rev3l 1.000 R6054 G1 225.01 N 10 39824150 S1548T T A missense Het probably benign 0.008 phenotype 07/14/2017
51 484311 UTSW Rora 0.884 R6054 G1 225.01 N 9 69378802 I471M A G missense Het probably benign 0.038 phenotype 07/14/2017
52 484331 UTSW Scube1 0.198 R6054 G1 225.01 N 15 83651676 V266L C A missense Het probably benign 0.428 phenotype 07/14/2017
53 484340 UTSW Sema6a 0.000 R6054 G1 225.01 N 18 47283403 D386N C T missense Het possibly damaging 0.945 phenotype 07/14/2017
54 484300 UTSW Siglecf 0.000 R6054 G1 225.01 N 7 43355006 L253Q T A missense Het probably damaging 0.996 phenotype 07/14/2017
55 484327 UTSW Spata31d1b 0.076 R6054 G1 225.01 N 13 59715650 H204R A G missense Het probably benign 0.000 07/14/2017
56 484304 UTSW Syt17 0.000 R6054 G1 225.01 N 7 118408133 T313A T C missense Het possibly damaging 0.910 07/14/2017
57 484314 UTSW Tbc1d32 0.894 R6054 G1 225.01 N 10 56162208 T578A T C missense Het possibly damaging 0.955 phenotype 07/14/2017
58 484301 UTSW Trpm1 0.000 R6054 G1 225.01 N 7 64268702 S597G A G missense Het probably benign 0.001 phenotype 07/14/2017
59 484296 UTSW Vmn2r9 0.123 R6054 G1 225.01 N 5 108848260 H174L T A missense Het probably damaging 0.991 07/14/2017
60 484317 UTSW Vrk2 0.172 R6054 G1 225.01 N 11 26486975 S281T A T missense Het probably benign 0.199 phenotype 07/14/2017
61 484312 UTSW Wdr48 1.000 R6054 G1 164.01 N 9 119907777 D22G A G missense Het probably damaging 1.000 phenotype 07/14/2017
62 484285 UTSW Zfp408 0.000 R6054 G1 225.01 N 2 91649291 V61L C A missense Het probably benign 0.001 phenotype 07/14/2017
63 484320 UTSW Zfp652 0.677 R6054 G1 225.01 N 11 95749863 A205T G A missense Het probably benign 0.000 07/14/2017
[records 1 to 63 of 63]