Incidental Mutations

79 incidental mutations are currently displayed, and affect 78 genes.
7 are Possibly Damaging.
28 are Probably Damaging.
34 are Probably Benign.
8 are Probably Null.
2 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 79 of 79] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 502424 UTSW A530064D06Rik 0.000 R6189 G1 210.01 N 17 48167054 A G start gained Het probably benign 02/27/2018
2 502407 UTSW Abca8a 0.065 R6189 G1 225.01 Y 11 110030884 D1448G T C missense Het probably damaging 1.000 0.833 02/27/2018
3 502409 UTSW Actn2 0.567 R6189 G1 225.01 Y 13 12276440 D693N C T missense Het probably damaging 0.995 phenotype 02/27/2018
4 502389 UTSW Adam3 0.000 R6189 G1 225.01 Y 8 24711336 I267R A C missense Het probably benign 0.012 phenotype 02/27/2018
5 502365 UTSW Akap2 0.099 R6189 G1 225.01 Y 4 57855928 E419G A G missense Het probably benign 0.003 phenotype 02/27/2018
6 502401 UTSW Aldh1l2 0.000 R6189 G1 225.01 Y 10 83508013 A G critical splice donor site 2 bp Het probably null 0.958 phenotype 02/27/2018
7 502353 UTSW C4bp 0.000 R6189 G1 225.01 Y 1 130636819 Y376C T C missense Het probably damaging 1.000 0.948 02/27/2018
8 502421 UTSW Cacna1h 0.000 R6189 G1 225.01 Y 17 25397844 W101R A G missense Het probably damaging 1.000 phenotype 02/27/2018
9 502393 UTSW Ccdc84 0.936 R6189 G1 225.01 Y 9 44410321 R328C G A missense Het probably benign 0.000 phenotype 02/27/2018
10 502381 UTSW Ccdc97 0.111 R6189 G1 225.01 Y 7 25716098 T47S T A missense Het probably benign 0.022 0.064 02/27/2018
11 502373 UTSW Cnot6l 0.389 R6189 G1 225.01 Y 5 96098277 T171I G A missense Het probably benign 0.176 02/27/2018
12 502376 UTSW Cntnap2 0.000 R6189 G1 225.01 Y 6 47271298 S1213T T A missense Het probably damaging 0.999 phenotype 02/27/2018
13 502372 UTSW Cxcl10 0.067 R6189 G1 225.01 Y 5 92348113 L55Q A T missense Het probably benign 0.003 phenotype 02/27/2018
14 502395 UTSW Cyp1a1 0.120 R6189 G1 225.01 Y 9 57700683 V198A T C missense Het probably damaging 0.997 phenotype 02/27/2018
15 502362 UTSW Dclre1b 1.000 R6189 G1 225.01 Y 3 103803533 V354A A G missense Het probably damaging 0.999 phenotype 02/27/2018
16 502426 UTSW Dmxl1 0.946 R6189 G1 225.01 Y 18 49893335 H1837Y C T missense Het probably benign 0.328 phenotype 02/27/2018
17 502397 UTSW Dnajc13 0.923 R6189 G1 225.01 Y 9 104213886 D665E G C missense Het probably benign 0.117 0.090 phenotype 02/27/2018
18 502427 UTSW Dnmbp 0.000 R6189 G1 225.01 Y 19 43890309 T108A T C missense Het probably benign 0.002 0.090 phenotype 02/27/2018
19 502428 UTSW Dnmbp 0.000 R6189 G1 225.01 Y 19 43901511 T606S T A missense Het probably benign 0.045 0.090 phenotype 02/27/2018
20 502358 UTSW Dok5 0.000 R6189 G1 225.01 Y 2 170800851 I23N T A missense Het probably damaging 0.992 phenotype 02/27/2018
21 502380 UTSW Eml2 0.000 R6189 G1 198.01 Y 7 19201163 V432I G A missense Het probably damaging 1.000 0.253 02/27/2018
22 502371 UTSW Epha5 0.000 R6189 G1 225.01 Y 5 84237540 F311I A T missense Het probably damaging 0.999 phenotype 02/27/2018
23 502351 UTSW Erbb4 1.000 R6189 G1 225.01 Y 1 68043916 M1059L T A missense Het probably benign 0.000 phenotype 02/27/2018
24 502415 UTSW Fbxo40 0.085 R6189 G1 225.01 Y 16 36966164 I681T A G missense Het probably benign 0.317 0.266 phenotype 02/27/2018
25 502361 UTSW Flg2 0.119 R6189 G1 225.01 Y 3 93220074 C2098S T A missense Het unknown 02/27/2018
26 502370 UTSW Gm10471 0.049 R6189 G1 225.01 N 5 26085693 I160T A G missense Het probably benign 0.016 02/27/2018
27 502410 UTSW Gm11397 0.224 R6189 G1 225.01 Y 13 33404444 E337D A T missense Het probably benign 0.000 02/27/2018
28 502359 UTSW Gpr87 0.000 R6189 G1 225.01 Y 3 59179229 D285V T A missense Het probably damaging 1.000 phenotype 02/27/2018
29 502378 UTSW Hrh1 0.000 R6189 G1 225.01 Y 6 114479998 V80D T A missense Het probably damaging 1.000 phenotype 02/27/2018
30 502418 UTSW Hunk 0.000 R6189 G1 225.01 Y 16 90487881 R351K G A missense Het probably benign 0.000 phenotype 02/27/2018
31 502366 UTSW Ifna12 0.057 R6189 G1 225.01 Y 4 88603011 W100R A G missense Het probably damaging 1.000 02/27/2018
32 502417 UTSW Ift57 1.000 R6189 G1 225.01 Y 16 49763813 G310S G A missense Het probably damaging 1.000 0.859 phenotype 02/27/2018
33 502383 UTSW Igf1r 1.000 R6189 G1 225.01 Y 7 68207336 Y1015* T A nonsense Het probably null 0.975 phenotype 02/27/2018
34 502377 UTSW Igkv14-130 0.259 R6189 G1 225.01 N 6 67791448 I96T T C missense Het probably damaging 1.000 02/27/2018
35 502390 UTSW Il34 0.081 R6189 G1 225.01 Y 8 110742718 S155N C T missense Het probably benign 0.004 0.090 phenotype 02/27/2018
36 502405 UTSW Itga7 0.444 R6189 G1 225.01 Y 10 128950403 S938P T C missense Het possibly damaging 0.759 phenotype 02/27/2018
37 502387 UTSW Itgam 0.123 R6189 G1 225.01 Y 7 128112504 M764V A G missense Het probably benign 0.038 phenotype 02/27/2018
38 502367 UTSW Lao1 0.063 R6189 G1 225.01 Y 4 118967880 M299K T A missense Het probably benign 0.003 0.090 phenotype 02/27/2018
39 502419 UTSW Lnpep 0.000 R6189 G1 225.01 Y 17 17566739 S533T A T missense Het possibly damaging 0.456 phenotype 02/27/2018
40 502357 UTSW Lrp4 0.530 R6189 G1 225.01 Y 2 91475234 V283A T C missense Het possibly damaging 0.628 phenotype 02/27/2018
41 502363 UTSW Magi3 0.563 R6189 G1 225.01 Y 3 104050865 H635N G T missense Het probably damaging 1.000 02/27/2018
42 502368 UTSW Mecr 1.000 R6189 G1 225.01 Y 4 131865254 A T critical splice acceptor site Het probably null 02/27/2018
43 502414 UTSW Mgrn1 0.000 R6189 G1 225.01 Y 16 4910810 T C critical splice donor site 2 bp Het probably null 0.960 phenotype 02/27/2018
44 502385 UTSW Micalcl 0.000 R6189 G1 225.01 Y 7 112412880 N646H A C missense Het probably damaging 0.996 0.647 02/27/2018
45 502355 UTSW Mymk 1.000 R6189 G1 225.01 Y 2 27067365 V39I C T missense Het possibly damaging 0.531 phenotype 02/27/2018
46 502404 UTSW Nav3 0.000 R6189 G1 225.01 Y 10 109720019 S1684G T C missense Het probably damaging 0.981 0.076 phenotype 02/27/2018
47 502382 UTSW Ntn5 0.058 R6189 G1 225.01 Y 7 45693220 D330V A T missense Het probably benign 0.000 0.090 phenotype 02/27/2018
48 502369 UTSW Nupl2 0.913 R6189 G1 225.01 Y 5 24175454 G149V G T missense Het probably damaging 1.000 02/27/2018
49 502412 UTSW Nutm2 0.000 R6189 G1 225.01 Y 13 50469738 V157D T A missense Het possibly damaging 0.913 0.179 02/27/2018
50 502406 UTSW Obscn 0.797 R6189 G1 225.01 Y 11 59069934 I3460V T C missense Het probably benign 0.004 0.147 phenotype 02/27/2018
51 502356 UTSW Olfr1037 0.064 R6189 G1 225.01 Y 2 86084913 M288K A T missense Het possibly damaging 0.527 phenotype 02/27/2018
52 502399 UTSW Pcdh15 0.000 R6189 G1 225.01 Y 10 74342651 A580V C T missense Het probably null 0.997 phenotype 02/27/2018
53 502425 UTSW Pcdhb10 0.087 R6189 G1 225.01 Y 18 37412403 H177Q T A missense Het probably damaging 0.985 0.647 phenotype 02/27/2018
54 502364 UTSW Pitx2 1.000 R6189 G1 225.01 Y 3 129218469 Y130H T C missense Het probably damaging 1.000 phenotype 02/27/2018
55 502402 UTSW Pmch 0.000 R6189 G1 225.01 Y 10 88091386 G T critical splice donor site 1 bp Het probably null 0.947 phenotype 02/27/2018
56 502400 UTSW Pofut2 1.000 R6189 G1 225.01 Y 10 77268586 I399N T A missense Het probably damaging 1.000 phenotype 02/27/2018
57 502388 UTSW Prr36 0.144 R6189 G1 225.01 Y 8 4214177 C A unclassified Het probably benign phenotype 02/27/2018
58 502403 UTSW Ptprq 0.372 R6189 G1 225.01 Y 10 107517887 C2256F C A missense Het probably damaging 1.000 0.233 phenotype 02/27/2018
59 502354 UTSW Rassf5 0.130 R6189 G1 177.01 Y 1 131244979 A51V G A missense Het probably damaging 0.998 0.064 phenotype 02/27/2018
60 502416 UTSW Retnla 0.000 R6189 G1 225.01 Y 16 48842895 I54V A G missense Het probably benign 0.001 0.090 phenotype 02/27/2018
61 502374 UTSW Rimbp2 0.000 R6189 G1 225.01 Y 5 128803897 L142P A G missense Het probably benign 0.000 0.090 phenotype 02/27/2018
62 502411 UTSW Ripk1 1.000 R6189 G1 225.01 Y 13 34032501 T564A A G missense Het probably benign 0.163 phenotype 02/27/2018
63 502392 UTSW Robo4 0.286 R6189 G1 225.01 Y 9 37403533 E228K G A missense Het probably benign 0.353 phenotype 02/27/2018
64 502384 UTSW Rsf1 1.000 R6189 G1 214.46 N 7 97579906 GGCG GGCGACGGCTGCG unclassified Homo probably benign phenotype 02/27/2018
65 502360 UTSW Rusc1 0.000 R6189 G1 225.01 Y 3 89089012 L132Q A T missense Het probably damaging 1.000 02/27/2018
66 502386 UTSW Setd1a 1.000 R6189 G1 225.01 Y 7 127778283 T C splice site 6 bp Het probably null phenotype 02/27/2018
67 502408 UTSW Slc38a6 0.091 R6189 G1 225.01 Y 12 73310196 K122M A T missense Het probably damaging 1.000 02/27/2018
68 502398 UTSW Susd5 0.062 R6189 G1 225.01 Y 9 114095658 D203V A T missense Het probably damaging 0.979 0.218 02/27/2018
69 502396 UTSW Trip4 0.838 R6189 G1 225.01 Y 9 65879152 R110* G A nonsense Het probably null 0.976 phenotype 02/27/2018
70 502352 UTSW Tuba4a 0.272 R6189 G1 225.01 Y 1 75216874 I95F T A missense Het probably benign 0.336 phenotype 02/27/2018
71 502394 UTSW Ube2q2 0.387 R6189 G1 225.01 Y 9 55162983 S70T T A missense Het probably benign 0.002 02/27/2018
72 502422 UTSW Umodl1 0.000 R6189 G1 225.01 Y 17 30996282 I1027V A G missense Het possibly damaging 0.746 02/27/2018
73 502350 UTSW Unc80 0.868 R6189 G1 225.01 Y 1 66677471 V2917I G A missense Het probably benign 0.326 0.090 phenotype 02/27/2018
74 502379 UTSW Vmn1r70 0.078 R6189 G1 225.01 Y 7 10633671 C29S T A missense Het probably benign 0.043 0.090 02/27/2018
75 502420 UTSW Vmn2r94 0.084 R6189 G1 225.01 Y 17 18257734 D138E A T missense Het probably benign 0.255 02/27/2018
76 502375 UTSW Wee2 0.000 R6189 G1 225.01 Y 6 40449683 H129Y C T missense Het probably damaging 1.000 02/27/2018
77 502423 UTSW Zfp318 0.000 R6189 G1 217.47 Y 17 46412514 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAG unclassified Het probably benign phenotype 02/27/2018
78 502391 UTSW Zfp872 0.060 R6189 G1 225.01 Y 9 22197131 D42V A T missense Het probably benign 0.007 0.090 02/27/2018
79 502413 UTSW Zic5 1.000 R6189 G1 80.01 N 14 122464974 D115A T G missense Het unknown 0.087 phenotype 02/27/2018
[records 1 to 79 of 79]