Incidental Mutations

57 incidental mutations are currently displayed, and affect 57 genes.
11 are Possibly Damaging.
22 are Probably Damaging.
15 are Probably Benign.
8 are Probably Null.
2 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 57 of 57] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 506073 UTSW 4833420G17Rik 0.000 R6255 G1 225.01 Y 13 119466123 V7E T A missense Het possibly damaging 0.949 0.179 02/28/2018
2 506075 UTSW Aars2 1.000 R6255 G1 172.01 Y 17 45514609 G333S G A missense Het probably damaging 0.999 phenotype 02/28/2018
3 506056 UTSW Aen 0.084 R6255 G1 225.01 Y 7 78905844 I85N T A missense Het probably damaging 1.000 0.289 02/28/2018
4 506082 UTSW Ahnak 0.306 R6255 G1 225.01 Y 19 9008025 H2224Q C A missense Het possibly damaging 0.950 0.087 phenotype 02/28/2018
5 506085 UTSW Aldh18a1 1.000 R6255 G1 225.01 Y 19 40580043 R41H C T missense Het possibly damaging 0.925 phenotype 02/28/2018
6 506040 UTSW Bpifb9b 0.142 R6255 G1 225.01 Y 2 154309364 W2R T A missense Het probably damaging 0.979 0.647 02/28/2018
7 506054 UTSW Caprin2 0.000 R6255 G1 225.01 Y 6 148877892 I139T A G missense Het probably benign 0.281 phenotype 02/28/2018
8 506070 UTSW Cdhr3 0.059 R6255 G1 225.01 Y 12 33053475 N381I T A missense Het probably damaging 0.997 02/28/2018
9 506053 UTSW Cecr2 1.000 R6255 G1 225.01 Y 6 120758050 Y721C A G missense Het probably damaging 1.000 phenotype 02/28/2018
10 529326 UTSW Cherp 0.964 R6255 G1 56.01 Y 8 72470881 A125D G T missense Het probably damaging 0.987 0.647 07/31/2018
11 506052 UTSW Cped1 0.074 R6255 G1 225.01 Y 6 22138715 G A splice site 5 bp Het probably null 0.976 02/28/2018
12 506080 UTSW Ctdp1 0.909 R6255 G1 225.01 Y 18 80459297 T A critical splice acceptor site Het probably null phenotype 02/28/2018
13 506084 UTSW Cyp2c55 0.078 R6255 G1 225.01 Y 19 39018667 I169T T C missense Het probably benign 0.249 phenotype 02/28/2018
14 506046 UTSW Cyp4a31 0.061 R6255 G1 225.01 Y 4 115574920 L418P T C missense Het possibly damaging 0.819 0.179 02/28/2018
15 506045 UTSW Efcab7 0.000 R6255 G1 225.01 Y 4 99829390 T C unclassified Het probably benign 0.090 02/28/2018
16 506039 UTSW Efcab8 0.099 R6255 G1 225.01 Y 2 153810268 W466R T C missense Het possibly damaging 0.867 0.067 02/28/2018
17 506076 UTSW Ehd3 0.000 R6255 G1 225.01 Y 17 73805413 N57K C A missense Het probably benign 0.170 phenotype 02/28/2018
18 506060 UTSW Ern2 0.141 R6255 G1 163.01 Y 7 122173272 K654N C A missense Het probably damaging 1.000 0.531 phenotype 02/28/2018
19 506033 UTSW Fbxo18 0.379 R6255 G1 225.01 Y 2 11748446 F879L A T missense Het probably benign 0.306 phenotype 02/28/2018
20 506059 UTSW Gde1 0.247 R6255 G1 225.01 Y 7 118691781 D92G T C missense Het probably null 0.002 0.449 phenotype 02/28/2018
21 506032 UTSW Gm4788 0.064 R6255 G1 225.01 Y 1 139753011 C256* A T nonsense Het probably null 02/28/2018
22 506077 UTSW Heatr5b 0.379 R6255 G1 225.01 Y 17 78803434 V995A A G missense Het probably damaging 1.000 0.330 02/28/2018
23 506062 UTSW Ifrd2 0.259 R6255 G1 225.01 Y 9 107592091 E346G A G missense Het probably damaging 0.994 0.324 02/28/2018
24 506038 UTSW Ism1 0.771 R6255 G1 217.47 Y 2 139746042 AACGGACCCGTTCTTGTGGCTATGCA AA small deletion Het probably benign 0.090 02/28/2018
25 506068 UTSW Itgb4 1.000 R6255 G1 225.01 Y 11 115998137 V1102A T C missense Het possibly damaging 0.832 phenotype 02/28/2018
26 506035 UTSW Itgb6 0.929 R6255 G1 225.01 Y 2 60605276 I710N A T missense Het probably damaging 0.999 0.760 phenotype 02/28/2018
27 506030 UTSW Kif1a 0.864 R6255 G1 225.01 Y 1 93019983 K1578E T C missense Het probably damaging 0.999 0.268 phenotype 02/28/2018
28 506063 UTSW Kif9 0.158 R6255 G1 156.01 Y 9 110517834 T C intron 3211 bp Het probably null 0.976 02/28/2018
29 506065 UTSW Kitl 0.335 R6255 G1 225.01 Y 10 100089233 *57Q T C makesense Het probably null phenotype 02/28/2018
30 506042 UTSW Lrat 0.165 R6255 G1 225.01 Y 3 82903505 V70F C A missense Het probably damaging 1.000 phenotype 02/28/2018
31 506071 UTSW Lrrc9 0.221 R6255 G1 225.01 Y 12 72487023 M1022K T A missense Het probably benign 0.329 02/28/2018
32 506061 UTSW Muc16 0.165 R6255 G1 225.01 Y 9 18655599 T1875A T C missense Het unknown phenotype 02/28/2018
33 506044 UTSW Mup4 0.055 R6255 G1 210.01 Y 4 59957890 N171I T A missense Het probably damaging 0.985 02/28/2018
34 506081 UTSW Npas4 0.570 R6255 G1 225.01 Y 19 4986375 T587I G A missense Het probably damaging 1.000 0.647 phenotype 02/28/2018
35 506050 UTSW Oas3 0.092 R6255 G1 154.01 Y 5 120771230 V217A A G missense Het probably benign 0.042 0.090 phenotype 02/28/2018
36 506066 UTSW Olfr786 0.085 R6255 G1 225.01 Y 10 129437688 N292S A G missense Het possibly damaging 0.946 phenotype 02/28/2018
37 506083 UTSW Osbp 0.965 R6255 G1 153.01 Y 19 11977953 A323D C A missense Het possibly damaging 0.642 0.156 phenotype 02/28/2018
38 506074 UTSW Panx2 0.000 R6255 G1 225.01 Y 15 89067618 R96H G A missense Het probably damaging 0.999 phenotype 02/28/2018
39 506078 UTSW Pcdhb18 0.182 R6255 G1 225.01 Y 18 37490484 R289Q G A missense Het probably benign 0.053 0.091 02/28/2018
40 506079 UTSW Piezo2 1.000 R6255 G1 225.01 Y 18 63121270 R385G T C missense Het possibly damaging 0.748 0.143 phenotype 02/28/2018
41 506043 UTSW Pkn2 1.000 R6255 G1 225.01 Y 3 142811599 T476A T C missense Het probably damaging 1.000 0.155 phenotype 02/28/2018
42 506055 UTSW Plekha4 0.115 R6255 G1 225.01 Y 7 45553802 T C utr 3 prime Het probably benign 0.090 02/28/2018
43 506058 UTSW Ppfibp2 0.000 R6255 G1 225.01 Y 7 107681762 S94P T C missense Het probably damaging 0.962 0.079 phenotype 02/28/2018
44 506036 UTSW Pramel7 0.077 R6255 G1 225.01 Y 2 87489663 I429L T A missense Het probably benign 0.005 02/28/2018
45 506034 UTSW Rif1 1.000 R6255 G1 225.01 Y 2 52085053 K325E A G missense Het probably damaging 1.000 0.160 phenotype 02/28/2018
46 506072 UTSW Ror2 1.000 R6255 G1 132.01 Y 13 53110542 Y826C T C missense Het probably damaging 1.000 phenotype 02/28/2018
47 506051 UTSW Rsph10b 0.071 R6255 G1 225.01 Y 5 143959746 G19R G A missense Het probably damaging 1.000 02/28/2018
48 506037 UTSW Slc20a1 1.000 R6255 G1 225.01 Y 2 129208004 N361D A G missense Het probably damaging 0.985 phenotype 02/28/2018
49 506031 UTSW Slc26a9 0.870 R6255 G1 225.01 Y 1 131763909 D630G A G missense Het probably benign 0.001 phenotype 02/28/2018
50 506067 UTSW Smtnl2 0.201 R6255 G1 225.01 Y 11 72401399 A274V G A missense Het probably damaging 0.996 0.089 02/28/2018
51 506064 UTSW Trank1 0.000 R6255 G1 225.01 Y 9 111352246 T C critical splice donor site 2 bp Het probably null 0.949 02/28/2018
52 506069 UTSW Tspan10 0.279 R6255 G1 225.01 Y 11 120444542 C159* T A nonsense Het probably null 02/28/2018
53 506049 UTSW Uba6 1.000 R6255 G1 225.01 Y 5 86164765 T23I G A missense Het probably benign 0.248 0.066 phenotype 02/28/2018
54 506057 UTSW Vmn2r74 0.116 R6255 G1 225.01 Y 7 85952451 T660A T C missense Het possibly damaging 0.899 0.179 02/28/2018
55 506047 UTSW Vwa5b1 0.000 R6255 G1 225.01 Y 4 138578672 N905S T C missense Het probably benign 0.003 02/28/2018
56 506041 UTSW Zfp831 0.000 R6255 G1 225.01 Y 2 174646421 L963P T C missense Het possibly damaging 0.956 02/28/2018
57 506048 UTSW Zfp990 0.069 R6255 G1 182.01 Y 4 145537789 N452K T A missense Het probably benign 0.001 02/28/2018
[records 1 to 57 of 57]