Incidental Mutations

55 incidental mutations are currently displayed, and affect 55 genes.
4 are Possibly Damaging.
22 are Probably Damaging.
20 are Probably Benign.
7 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 55 of 55] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 517579 UTSW Abca7 0.000 R6460 G1 225.01 N 10 80009028 H1528L A T missense Het probably benign 0.037 phenotype 05/21/2018
2 517596 UTSW Ablim1 0.421 R6460 G1 225.01 N 19 57079839 S263P A G missense Het possibly damaging 0.956 phenotype 05/21/2018
3 517586 UTSW Ahnak2 0.069 R6460 G1 225.01 N 12 112786990 E104G T C missense Het probably null 0.268 05/21/2018
4 517581 UTSW Apof R6460 G1 225.01 N 10 128269217 M80K T A missense Het probably damaging 0.999 phenotype 05/21/2018
5 517545 UTSW Arfgef1 1.000 R6460 G1 225.01 N 1 10213060 R208H C T missense Het probably damaging 1.000 phenotype 05/21/2018
6 517837 UTSW Arhgef33 0.089 R6460 G1 225.01 N 17 80349589 A G splice site 3 bp Het probably null 05/21/2018
7 517567 UTSW Atxn2l 0.916 R6460 G1 136.47 N 7 126494248 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 05/21/2018
8 517578 UTSW Cabcoco1 0.080 R6460 G1 225.01 N 10 68516381 K34E T C missense Het probably damaging 0.998 05/21/2018
9 517546 UTSW Col4a4 0.103 R6460 G1 225.01 N 1 82466532 G1338V C A missense Het unknown phenotype 05/21/2018
10 517570 UTSW Coq9 0.199 R6460 G1 225.01 N 8 94853186 D256E T A missense Het probably damaging 0.992 phenotype 05/21/2018
11 517595 UTSW Dnajc18 0.171 R6460 G1 225.01 N 18 35700910 C41S A T missense Het probably benign 0.415 05/21/2018
12 517553 UTSW Dnajc6 0.128 R6460 G1 225.01 N 4 101615598 I307M A G missense Het probably damaging 1.000 phenotype 05/21/2018
13 517562 UTSW Emg1 1.000 R6460 G1 225.01 N 6 124711907 V46A A G missense Het probably damaging 0.987 phenotype 05/21/2018
14 517554 UTSW Eya3 0.755 R6460 G1 225.01 N 4 132680863 S157G A G missense Het probably damaging 0.969 phenotype 05/21/2018
15 517577 UTSW Eya4 1.000 R6460 G1 225.01 N 10 23152012 N274S T C missense Het probably benign 0.046 phenotype 05/21/2018
16 517565 UTSW Fan1 0.000 R6460 G1 225.01 N 7 64372486 N340Y T A missense Het probably damaging 0.974 0.101 phenotype 05/21/2018
17 517571 UTSW Fat3 0.492 R6460 G1 225.01 N 9 15967000 V3395A A G missense Het probably damaging 1.000 phenotype 05/21/2018
18 517838 UTSW Fchsd1 0.121 R6460 G1 225.01 N 18 37959844 A T splice site Het probably null 05/21/2018
19 517547 UTSW Gm4846 0.101 R6460 G1 225.01 N 1 166497513 V3A A G missense Het probably benign 0.002 05/21/2018
20 517836 UTSW Hecw2 0.608 R6460 G1 225.01 N 1 53868833 T A splice site 3 bp Het probably null phenotype 05/21/2018
21 517561 UTSW Herc3 0.000 R6460 G1 225.01 N 6 58890123 I10N T A missense Het probably damaging 1.000 phenotype 05/21/2018
22 517576 UTSW Hhatl 0.000 R6460 G1 225.01 N 9 121789522 R138H C T missense Het probably benign 0.321 05/21/2018
23 517594 UTSW Hspa9 0.968 R6460 G1 225.01 N 18 34952712 H35Q A T missense Het probably benign 0.000 phenotype 05/21/2018
24 517563 UTSW Irgq 0.074 R6460 G1 225.01 N 7 24533690 S319T T A missense Het probably benign 0.001 05/21/2018
25 517555 UTSW Kif1b 1.000 R6460 G1 225.01 N 4 149192596 M1337V T C missense Het probably benign 0.159 0.074 phenotype 05/21/2018
26 517558 UTSW Ksr2 0.139 R6460 G1 225.01 N 5 117756384 T A critical splice donor site 2 bp Het probably null phenotype 05/21/2018
27 517580 UTSW Lrriq1 0.074 R6460 G1 225.01 N 10 103200698 I865V T C missense Het probably damaging 0.995 05/21/2018
28 517574 UTSW Map2k1 1.000 R6460 G1 225.01 N 9 64187295 L355P A G missense Het probably damaging 0.967 phenotype 05/21/2018
29 517572 UTSW Muc16 0.201 R6460 G1 225.01 N 9 18640516 I4827T A G missense Het probably benign 0.015 phenotype 05/21/2018
30 517582 UTSW Myh1 0.000 R6460 G1 225.01 N 11 67221376 V1752A T C missense Het probably benign 0.000 phenotype 05/21/2018
31 517566 UTSW Nfatc2ip 0.262 R6460 G1 180.01 N 7 126387737 V282A A G missense Het probably damaging 1.000 phenotype 05/21/2018
32 517569 UTSW Nrg1 1.000 R6460 G1 225.01 N 8 31818533 E485V T A missense Het probably damaging 0.999 phenotype 05/21/2018
33 517587 UTSW Ofcc1 0.000 R6460 G1 225.01 N 13 40287979 D2G T C missense Het probably damaging 0.985 phenotype 05/21/2018
34 517573 UTSW Olfr958 0.094 R6460 G1 217.47 N 9 39550792 CAGAG CAG frame shift Het probably null phenotype 05/21/2018
35 517556 UTSW Pclo 0.000 R6460 G1 225.01 N 5 14679132 T C unclassified Het probably benign 0.090 phenotype 05/21/2018
36 517559 UTSW Pom121 1.000 R6460 G1 225.01 N 5 135391683 K295E T C missense Het unknown 05/21/2018
37 517591 UTSW Rb1 1.000 R6460 G1 225.01 N 14 73278454 I294R A C missense Het probably benign 0.061 phenotype 05/21/2018
38 517550 UTSW Schip1 0.720 R6460 G1 152.01 N 3 68494894 S101R C A missense Het probably benign 0.371 phenotype 05/21/2018
39 517589 UTSW Sec24c 1.000 R6460 G1 225.01 N 14 20690800 Y629N T A missense Het probably damaging 1.000 phenotype 05/21/2018
40 517564 UTSW Shkbp1 0.000 R6460 G1 210.01 N 7 27350538 H305L T A missense Het probably benign 0.014 05/21/2018
41 517585 UTSW Spag9 0.814 R6460 G1 225.01 N 11 94068975 I187T T C missense Het probably damaging 0.997 phenotype 05/21/2018
42 517557 UTSW Srp72 0.942 R6460 G1 225.01 N 5 76987991 T256K C A missense Het probably damaging 0.997 phenotype 05/21/2018
43 517568 UTSW Stk32c 0.000 R6460 G1 147.01 N 7 139105274 N320I T A missense Het probably damaging 0.999 phenotype 05/21/2018
44 517584 UTSW Stxbp4 0.000 R6460 G1 225.01 N 11 90606985 S163T A T missense Het probably benign 0.353 05/21/2018
45 517551 UTSW Sycp1 0.487 R6460 G1 225.01 N 3 102925253 Y199S T G missense Het probably damaging 0.999 phenotype 05/21/2018
46 517560 UTSW Tpk1 1.000 R6460 G1 225.01 N 6 43469027 D159G T C missense Het probably benign 0.008 phenotype 05/21/2018
47 517590 UTSW Trav21-dv12 0.115 R6460 G1 180.01 N 14 53876734 H104Y C T missense Het probably benign 0.001 05/21/2018
48 517575 UTSW Trip4 0.839 R6460 G1 225.01 N 9 65881020 Y48N A T missense Het probably damaging 1.000 phenotype 05/21/2018
49 517552 UTSW Trmt10b 0.206 R6460 G1 225.01 N 4 45314322 T255A A G missense Het possibly damaging 0.812 05/21/2018
50 517548 UTSW Ttn 1.000 R6460 G1 225.01 N 2 76916888 Q4606* G A nonsense Het probably null phenotype 05/21/2018
51 517588 UTSW Vcan 1.000 R6460 G1 225.01 N 13 89690687 K2246M T A missense Het possibly damaging 0.610 phenotype 05/21/2018
52 517593 UTSW Zfp438 0.103 R6460 G1 225.01 N 18 5213603 G452C C A missense Het probably damaging 0.999 05/21/2018
53 517592 UTSW Zfp54 0.000 R6460 G1 225.01 N 17 21433742 I166N T A missense Het probably benign 0.000 05/21/2018
54 517583 UTSW Zfp735 0.073 R6460 G1 225.01 N 11 73711652 V474A T C missense Het probably benign 0.326 05/21/2018
55 517549 UTSW Zfp831 0.000 R6460 G1 225.01 N 2 174646567 G1012W G T missense Het possibly damaging 0.463 05/21/2018
[records 1 to 55 of 55]