Incidental Mutations

40 incidental mutations are currently displayed, and affect 39 genes.
6 are Possibly Damaging.
13 are Probably Damaging.
15 are Probably Benign.
6 are Probably Null.
2 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 40 of 40] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 524125 UTSW Abca12 1.000 R6582 G1 225.01 Y 1 71258225 T2369A T C missense Het probably benign 0.004 phenotype 06/22/2018
2 524183 UTSW Abhd6 0.000 R6582 G1 215.01 Y 14 8042826 G128C G T missense Het probably damaging 1.000 0.966 06/22/2018
3 524184 UTSW Abhd6 0.000 R6582 G1 212.01 Y 14 8042828 T G critical splice donor site 2 bp Het probably null 0.949 06/22/2018
4 524154 UTSW Acsm3 0.000 R6582 G1 225.01 Y 7 119779673 E426G A G missense Het probably benign 0.000 0.090 phenotype 06/22/2018
5 524164 UTSW Ankrd11 1.000 R6582 G1 225.01 Y 8 122891629 D1828G T C missense Het probably benign 0.004 0.063 phenotype 06/22/2018
6 524200 UTSW Asmt 0.104 R6582 G1 129.34 Y X 170675031 T A critical splice donor site 2 bp Het probably null phenotype 06/22/2018
7 524166 UTSW Casp4 0.000 R6582 G1 225.01 Y 9 5324884 Q232R A G missense Het probably benign 0.014 phenotype 06/22/2018
8 524162 UTSW Cenpt 0.929 R6582 G1 225.01 Y 8 105849201 L171* A T nonsense Het probably null phenotype 06/22/2018
9 524174 UTSW Chd3 0.000 R6582 G1 110.47 Y 11 69369156 AGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGG unclassified Het probably benign phenotype 06/22/2018
10 524123 UTSW Col5a2 1.000 R6582 G1 225.01 Y 1 45390115 H948N G T missense Het possibly damaging 0.913 phenotype 06/22/2018
11 524172 UTSW Dnah9 0.251 R6582 G1 208.01 Y 11 66061097 H1859N G T missense Het probably damaging 1.000 0.428 phenotype 06/22/2018
12 524170 UTSW Dscaml1 0.553 R6582 G1 194.01 Y 9 45752806 R1993Q G A missense Het probably benign 0.003 phenotype 06/22/2018
13 524142 UTSW Fbxw8 0.414 R6582 G1 225.01 Y 5 118124963 R217L C A missense Het probably benign 0.276 phenotype 06/22/2018
14 524181 UTSW Flnb 1.000 R6582 G1 225.01 Y 14 7892275 T G critical splice donor site 2 bp Het probably null 0.950 phenotype 06/22/2018
15 524140 UTSW Fyb2 0.072 R6582 G1 225.01 Y 4 104945542 N214D A G missense Het probably benign 0.004 06/22/2018
16 524138 UTSW Gbp2b 0.000 R6582 G1 225.01 Y 3 142611040 E484G A G missense Het possibly damaging 0.532 phenotype 06/22/2018
17 524178 UTSW Gzmk 0.000 R6582 G1 225.01 Y 13 113180511 Y45H A G missense Het probably damaging 0.998 0.308 phenotype 06/22/2018
18 524136 UTSW Ivl 0.000 R6582 G1 217.47 Y 3 92571910 CCTGCTGCTGCTGCT CCTGCTGCTGCT small deletion Het probably benign 0.090 phenotype 06/22/2018
19 524192 UTSW Kcnj6 0.082 R6582 G1 225.01 Y 16 94832826 V142A A G missense Het possibly damaging 0.934 0.235 phenotype 06/22/2018
20 524144 UTSW Klri2 0.067 R6582 G1 225.01 Y 6 129739133 I81K A T missense Het possibly damaging 0.655 0.179 06/22/2018
21 524196 UTSW Lama3 1.000 R6582 G1 225.01 Y 18 12577840 V3144E T A missense Het probably damaging 0.997 0.389 phenotype 06/22/2018
22 524129 UTSW Mark1 0.321 R6582 G1 222.01 Y 1 184912589 S390L G A missense Het possibly damaging 0.816 0.179 06/22/2018
23 524168 UTSW Mbd3l1 0.000 R6582 G1 225.01 Y 9 18484728 Y50H T C missense Het probably benign 0.247 phenotype 06/22/2018
24 524190 UTSW Mcat 0.433 R6582 G1 225.01 Y 15 83549182 N220S T C missense Het probably benign 0.003 phenotype 06/22/2018
25 524158 UTSW Muc2 0.080 R6582 G1 225.01 Y 7 141696698 E81G A G missense Het probably benign 0.004 phenotype 06/22/2018
26 524198 UTSW Neto1 0.000 R6582 G1 225.01 Y 18 86494860 K327* A T nonsense Het probably null phenotype 06/22/2018
27 524132 UTSW Olfr1200 0.060 R6582 G1 225.01 Y 2 88768243 L24Q A T missense Het probably damaging 0.965 0.647 phenotype 06/22/2018
28 524127 UTSW Olfr218 0.089 R6582 G1 213.01 Y 1 173204280 R308L G T missense Het probably benign 0.002 phenotype 06/22/2018
29 524150 UTSW Olfr654 0.070 R6582 G1 225.01 Y 7 104588011 L69P T C missense Het probably damaging 0.999 phenotype 06/22/2018
30 524152 UTSW Olfr656 0.070 R6582 G1 225.01 Y 7 104618441 Y254F A T missense Het probably damaging 0.999 phenotype 06/22/2018
31 524156 UTSW Pidd1 0.000 R6582 G1 225.01 Y 7 141439581 V722D A T missense Het probably damaging 1.000 phenotype 06/22/2018
32 524186 UTSW Ppp2r2a 1.000 R6582 G1 225.01 Y 14 67019804 H326N G T missense Het probably damaging 1.000 0.817 phenotype 06/22/2018
33 524160 UTSW Smarca5 1.000 R6582 G1 225.01 Y 8 80719652 T473I G A missense Het probably damaging 0.997 0.253 phenotype 06/22/2018
34 524134 UTSW Spg11 0.156 R6582 G1 225.01 Y 2 122092292 W892L C A missense Het probably damaging 0.990 0.360 phenotype 06/22/2018
35 524146 UTSW Tas2r110 0.053 R6582 G1 225.01 Y 6 132868285 I93N T A missense Het possibly damaging 0.935 0.318 06/22/2018
36 524194 UTSW Tiam2 0.000 R6582 G1 217.47 Y 17 3414622 CGGG CGGGG frame shift Het probably null 0.976 phenotype 06/22/2018
37 524148 UTSW Vmn1r71 0.058 R6582 G1 225.01 Y 7 10748681 I27F T A missense Het probably benign 0.003 06/22/2018
38 524176 UTSW Vsnl1 0.438 R6582 G1 225.01 Y 12 11326488 V132A A G missense Het probably benign 0.014 0.148 phenotype 06/22/2018
39 524131 UTSW Wdsub1 0.139 R6582 G1 201.01 Y 2 59878308 T74A T C missense Het probably damaging 1.000 0.139 06/22/2018
40 524188 UTSW Ywhaz 0.595 R6582 G1 225.01 Y 15 36790922 Y19C T C missense Het probably damaging 1.000 0.935 phenotype 06/22/2018
[records 1 to 40 of 40]