Incidental Mutations

36 incidental mutations are currently displayed, and affect 36 genes.
7 are Possibly Damaging.
13 are Probably Damaging.
7 are Probably Benign.
7 are Probably Null.
1 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 36 of 36] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 527121 UTSW 4933408B17Rik 0.092 R6670 G1 225.01 Y 18 34586266 V167A A G missense Het possibly damaging 0.563 0.468 07/23/2018
2 527122 UTSW Abcc2 0.000 R6670 G1 225.01 Y 19 43839411 A G utr 3 prime Het probably benign 0.090 phenotype 07/23/2018
3 527097 UTSW Acsm3 0.000 R6670 G1 225.01 Y 7 119780755 T A unclassified 3076 bp Het probably null phenotype 07/23/2018
4 527099 UTSW AW551984 0.072 R6670 G1 225.01 Y 9 39592996 D558G T C missense Het probably damaging 0.995 07/23/2018
5 527100 UTSW Bcl9l 0.000 R6670 G1 217.47 Y 9 44507072 GTGAACATGAACATGAACATGAAC GTGAACATGAACATGAACATGAACATGAAC small insertion Het probably benign phenotype 07/23/2018
6 527104 UTSW Ccdc12 0.721 R6670 G1 225.01 Y 9 110708527 T G critical splice donor site 2 bp Het probably null 07/23/2018
7 527110 UTSW Ctsl 1.000 R6670 G1 225.01 Y 13 64364102 T C unclassified 990 bp Het probably null 0.976 phenotype 07/23/2018
8 527095 UTSW Cul1 1.000 R6670 G1 225.01 Y 6 47517134 D460E T A missense Het probably damaging 1.000 phenotype 07/23/2018
9 527092 UTSW Dnttip2 0.967 R6670 G1 225.01 Y 3 122276221 S362T T A missense Het probably damaging 0.991 0.068 phenotype 07/23/2018
10 527103 UTSW Fbxw16 0.056 R6670 G1 225.01 Y 9 109438212 D317V T A missense Het probably damaging 1.000 0.691 07/23/2018
11 527098 UTSW Fbxw9 0.086 R6670 G1 225.01 Y 8 85062210 N196K T A missense Het possibly damaging 0.552 phenotype 07/23/2018
12 527108 UTSW Grap 0.000 R6670 G1 225.01 Y 11 61660238 D32G A G missense Het probably damaging 0.997 0.298 phenotype 07/23/2018
13 527105 UTSW Hhatl 0.000 R6670 G1 225.01 Y 9 121789071 D206G T C missense Het probably damaging 0.961 07/23/2018
14 527091 UTSW Hrnr 0.000 R6670 G1 225.01 Y 3 93331885 Q3143H A T missense Het unknown 07/23/2018
15 527109 UTSW Ighv1-62-1 0.267 R6670 G1 225.01 Y 12 115386909 Y46C T C missense Het probably damaging 1.000 0.647 07/23/2018
16 527117 UTSW Krtap16-3 0.273 R6670 G1 225.01 Y 16 88962652 Y58N A T missense Het unknown 07/23/2018
17 527111 UTSW Mef2c 1.000 R6670 G1 225.01 Y 13 83662597 K384R A G missense Het probably damaging 1.000 0.117 phenotype 07/23/2018
18 527114 UTSW Nalcn 1.000 R6670 G1 225.01 Y 14 123464672 Y476H A G missense Het possibly damaging 0.956 0.694 phenotype 07/23/2018
19 527113 UTSW Oxgr1 0.000 R6670 G1 225.01 Y 14 120022257 N179K A T missense Het probably damaging 1.000 0.647 phenotype 07/23/2018
20 527112 UTSW Polk 0.163 R6670 G1 225.01 Y 13 96496630 Q302* G A nonsense Het probably null 0.975 phenotype 07/23/2018
21 527085 UTSW Rab3gap1 0.247 R6670 G1 225.01 Y 1 127930775 S540R T A missense Het probably benign 0.000 phenotype 07/23/2018
22 527106 UTSW Samd5 0.105 R6670 G1 225.01 Y 10 9629064 A T splice site Het probably null 07/23/2018
23 527089 UTSW Sema6d 0.000 R6670 G1 217.47 Y 2 124654842 GTGATAC G small deletion Het probably benign 0.090 phenotype 07/23/2018
24 527107 UTSW Slc1a6 0.094 R6670 G1 225.01 Y 10 78787812 A15D C A missense Het probably benign 0.004 phenotype 07/23/2018
25 527120 UTSW Slc8a1 1.000 R6670 G1 225.01 Y 17 81649454 C52R A G missense Het probably damaging 1.000 0.884 phenotype 07/23/2018
26 527118 UTSW Sod2 1.000 R6670 G1 166.01 Y 17 13008365 Y69N T A missense Het possibly damaging 0.946 0.320 phenotype 07/23/2018
27 527086 UTSW Tank 0.698 R6670 G1 225.01 Y 2 61644424 T C critical splice donor site 2 bp Het probably null 0.950 phenotype 07/23/2018
28 527116 UTSW Tbc1d23 0.763 R6670 G1 225.01 Y 16 57214217 I73N A T missense Het probably benign 0.001 0.080 phenotype 07/23/2018
29 527119 UTSW Tnf 0.000 R6670 G1 225.01 Y 17 35201824 M6R A C missense Het possibly damaging 0.734 0.277 phenotype 07/23/2018
30 527115 UTSW Trmt2a 0.000 R6670 G1 225.01 Y 16 18250477 A16V C T missense Het possibly damaging 0.574 phenotype 07/23/2018
31 527087 UTSW Ttn 1.000 R6670 G1 225.01 Y 2 76725711 Y21990H A G missense Het probably damaging 0.999 0.270 phenotype 07/23/2018
32 527102 UTSW Uaca 0.135 R6670 G1 225.01 Y 9 60872024 S1231L C T missense Het probably benign 0.085 0.090 phenotype 07/23/2018
33 527088 UTSW Ubr1 0.728 R6670 G1 225.01 Y 2 120924130 A G critical splice donor site 2 bp Het probably null phenotype 07/23/2018
34 527093 UTSW Unc13b 0.705 R6670 G1 225.01 Y 4 43255562 D3849G A G missense Het probably damaging 0.993 0.173 phenotype 07/23/2018
35 527096 UTSW Vmn2r75 0.075 R6670 G1 225.01 Y 7 86148436 D723V T A missense Het probably damaging 1.000 0.647 07/23/2018
36 527094 UTSW Wnt2 0.485 R6670 G1 225.01 Y 6 18028092 V48L C A missense Het possibly damaging 0.901 0.121 phenotype 07/23/2018
[records 1 to 36 of 36]