Incidental Mutations

103 incidental mutations are currently displayed, and affect 101 genes.
22 are Possibly Damaging.
39 are Probably Damaging.
29 are Probably Benign.
11 are Probably Null.
2 create premature stop codons.
5 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 103] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 528467 UTSW 1700010I14Rik 0.000 R6736 G1 225.01 N 17 8992268 I83T T C missense Het probably benign 0.007 07/24/2018
2 528400 UTSW Aadacl4 0.061 R6736 G1 225.01 N 4 144623339 S389A T G missense Het possibly damaging 0.824 07/24/2018
3 528441 UTSW Abca13 0.000 R6736 G1 225.01 N 11 9465058 S4042C A T missense Het probably damaging 0.995 phenotype 07/24/2018
4 528446 UTSW Acaca 1.000 R6736 G1 225.01 N 11 84238838 V340I G A missense Het probably benign 0.046 phenotype 07/24/2018
5 528404 UTSW Acox3 0.000 R6736 G1 225.01 N 5 35588854 T A critical splice donor site 2 bp Het probably null phenotype 07/24/2018
6 528442 UTSW Acsl6 0.434 R6736 G1 225.01 N 11 54325166 E124A A C missense Het probably damaging 1.000 phenotype 07/24/2018
7 528395 UTSW Adamtsl1 0.136 R6736 G1 225.01 N 4 86342247 H898Q T A missense Het probably damaging 1.000 phenotype 07/24/2018
8 528392 UTSW Agl 0.168 R6736 G1 225.01 N 3 116781680 S603P A G missense Het probably damaging 0.984 phenotype 07/24/2018
9 528412 UTSW Apobec1 0.000 R6736 G1 225.01 N 6 122581675 M31K A T missense Het probably null phenotype 07/24/2018
10 528473 UTSW Armc4 0.222 R6736 G1 225.01 N 18 7223586 V486F C A missense Het probably damaging 0.981 phenotype 07/24/2018
11 528377 UTSW Astn1 0.088 R6736 G1 213.01 N 1 158511148 T C critical splice donor site 2 bp Het probably null phenotype 07/24/2018
12 528405 UTSW Atp8a1 0.000 R6736 G1 225.01 N 5 67667617 D790E G T missense Het probably damaging 1.000 phenotype 07/24/2018
13 528384 UTSW Bahd1 0.000 R6736 G1 225.01 N 2 118915975 M25R T G missense Het possibly damaging 0.538 phenotype 07/24/2018
14 528376 UTSW BC034090 0.061 R6736 G1 225.01 N 1 155241930 N147K A T missense Het possibly damaging 0.922 07/24/2018
15 528438 UTSW Bfsp2 0.134 R6736 G1 225.01 N 9 103480204 A8E G T missense Het possibly damaging 0.603 phenotype 07/24/2018
16 528466 UTSW Brwd1 0.000 R6736 G1 225.01 N 16 96068572 I85N A T missense Het probably damaging 0.999 phenotype 07/24/2018
17 528396 UTSW Ccdc24 0.000 R6736 G1 225.01 N 4 117870535 N145I T A missense Het possibly damaging 0.808 07/24/2018
18 528423 UTSW Cdhr5 0.060 R6736 G1 225.01 N 7 141272531 Q141K G T missense Het probably damaging 0.973 phenotype 07/24/2018
19 528420 UTSW Cfap46 0.000 R6736 G1 225.01 N 7 139619971 V1998A A G missense Het possibly damaging 0.916 07/24/2018
20 528425 UTSW Csmd1 0.000 R6736 G1 225.01 N 8 16002626 Y2166F T A missense Het probably damaging 0.993 phenotype 07/24/2018
21 528424 UTSW Cul4a 0.692 R6736 G1 225.01 N 8 13136219 S474A T G missense Het probably benign 0.003 phenotype 07/24/2018
22 528381 UTSW Cutal 0.129 R6736 G1 225.01 N 2 34888137 T112A A G missense Het probably benign 0.065 07/24/2018
23 528378 UTSW Dcaf6 0.000 R6736 G1 225.01 N 1 165399785 S258A A C missense Het possibly damaging 0.768 07/24/2018
24 528453 UTSW Dek 0.694 R6736 G1 225.01 N 13 47099390 V180M C T missense Het probably damaging 0.999 phenotype 07/24/2018
25 528406 UTSW Dspp 0.000 R6736 G1 225.01 N 5 104178175 D801E C A missense Het unknown phenotype 07/24/2018
26 528459 UTSW Egflam 0.000 R6736 G1 225.01 N 15 7219725 T871A T C missense Het probably damaging 1.000 phenotype 07/24/2018
27 528454 UTSW Erbin 0.000 R6736 G1 225.01 N 13 103834766 S781T A T missense Het possibly damaging 0.718 phenotype 07/24/2018
28 528390 UTSW Erich6 0.062 R6736 G1 225.01 N 3 58625054 H377Q A T missense Het probably damaging 1.000 07/24/2018
29 528397 UTSW Exo5 0.000 R6736 G1 225.01 N 4 120921756 G304V C A missense Het probably damaging 0.992 phenotype 07/24/2018
30 528387 UTSW Eya2 0.764 R6736 G1 225.01 N 2 165716037 S184R C A missense Het possibly damaging 0.804 phenotype 07/24/2018
31 528428 UTSW Fhod1 0.171 R6736 G1 225.01 N 8 105337890 G A unclassified Het probably benign 07/24/2018
32 528449 UTSW G6pc3 0.000 R6736 G1 225.01 N 11 102193670 Y302C A G missense Het possibly damaging 0.624 phenotype 07/24/2018
33 528465 UTSW Gart 1.000 R6736 G1 225.01 N 16 91636107 D318G T C missense Het probably benign 0.211 phenotype 07/24/2018
34 528399 UTSW Gm10300 0.110 R6736 G1 195.01 N 4 132074935 T C intron Het probably benign 07/24/2018
35 528448 UTSW Gm11937 R6736 G1 225.01 N 11 99610074 V39A A G missense Het probably damaging 0.972 07/24/2018
36 528379 UTSW Gm16432 0.117 R6736 G1 225.01 N 1 178017712 Y99* T A nonsense Het probably null 07/24/2018
37 528386 UTSW Gm21994 0.455 R6736 G1 225.01 N 2 150255278 Y77F T A missense Het possibly damaging 0.953 07/24/2018
38 528388 UTSW Gnas 1.000 R6736 G1 225.01 N 2 174334251 M60T T C missense Het probably damaging 0.977 phenotype 07/24/2018
39 528476 UTSW Grk5 0.000 R6736 G1 92.01 N 19 60890626 R16L G T missense Het probably damaging 0.988 phenotype 07/24/2018
40 528391 UTSW Hcn3 0.294 R6736 G1 225.01 N 3 89152674 L221P A G missense Het probably damaging 0.998 phenotype 07/24/2018
41 528416 UTSW Hddc3 0.000 R6736 G1 225.01 N 7 80343196 R20Q G A missense Het possibly damaging 0.787 07/24/2018
42 528407 UTSW Hectd4 0.929 R6736 G1 225.01 N 5 121277725 Y530H T C missense Het possibly damaging 0.861 07/24/2018
43 528447 UTSW Igf2bp1 0.180 R6736 G1 225.01 N 11 95973122 H247Q A T missense Het probably benign 0.141 phenotype 07/24/2018
44 528411 UTSW Igkv4-70 R6736 G1 225.01 N 6 69267928 D103V T A missense Het probably damaging 1.000 07/24/2018
45 528413 UTSW Itpr2 0.000 R6736 G1 225.01 N 6 146325170 M1359L T A missense Het probably damaging 0.997 phenotype 07/24/2018
46 528463 UTSW Kalrn 0.928 R6736 G1 225.01 N 16 34217923 L1013S A G missense Het probably damaging 1.000 phenotype 07/24/2018
47 528417 UTSW Kctd21 0.088 R6736 G1 225.01 N 7 97348084 R255W C T missense Het probably damaging 0.994 07/24/2018
48 528462 UTSW Krt18 0.000 R6736 G1 225.01 N 15 102030769 Y263N T A missense Het probably benign 0.378 phenotype 07/24/2018
49 528385 UTSW Lamp5 0.000 R6736 G1 202.01 N 2 136059563 N102K C G missense Het possibly damaging 0.507 0.179 07/24/2018
50 528443 UTSW Larp1 1.000 R6736 G1 225.01 N 11 58042647 G A splice site 5 bp Het probably null 07/24/2018
51 528474 UTSW Lmnb1 1.000 R6736 G1 225.01 N 18 56728469 N144S A G missense Het probably damaging 1.000 phenotype 07/24/2018
52 528382 UTSW Lrp2 1.000 R6736 G1 225.01 N 2 69448211 T3933S T A missense Het probably benign 0.021 phenotype 07/24/2018
53 528389 UTSW Lrrc34 0.057 R6736 G1 225.01 N 3 30624859 N363S T C missense Het probably benign 0.028 07/24/2018
54 528440 UTSW Lrriq1 0.085 R6736 G1 225.01 N 10 103181889 T C critical splice acceptor site Het probably null 07/24/2018
55 528461 UTSW Mafa 0.479 R6736 G1 141.01 N 15 75747780 G48V C A missense Het unknown phenotype 07/24/2018
56 528426 UTSW Mboat4 0.000 R6736 G1 225.01 N 8 34124521 S371P T C missense Het possibly damaging 0.637 phenotype 07/24/2018
57 528436 UTSW Mei4 0.162 R6736 G1 225.01 N 9 82025624 M237L A T missense Het probably benign 0.000 phenotype 07/24/2018
58 528398 UTSW Mfsd2a 0.457 R6736 G1 225.01 N 4 122951261 D219G T C missense Het probably benign 0.000 phenotype 07/24/2018
59 528437 UTSW Msl2 0.951 R6736 G1 225.01 N 9 101101002 N192D A G missense Het probably damaging 0.985 07/24/2018
60 528457 UTSW Mycbp2 1.000 R6736 G1 225.01 N 14 103191567 R2358M C A missense Het probably null 0.999 phenotype 07/24/2018
61 528444 UTSW Myh10 1.000 R6736 G1 225.01 N 11 68745339 T185A A G missense Het probably damaging 0.998 phenotype 07/24/2018
62 528408 UTSW Nipsnap2 0.000 R6736 G1 195.01 N 5 129745288 T C critical splice donor site 2 bp Het probably null phenotype 07/24/2018
63 528380 UTSW Notch1 1.000 R6736 G1 165.01 N 2 26460286 T2281A T C missense Het probably benign 0.006 phenotype 07/24/2018
64 528383 UTSW Olfr1165-ps 0.081 R6736 G1 225.01 N 2 88101603 C128F C A missense Het probably benign 0.026 07/24/2018
65 528475 UTSW Olfr1436 0.078 R6736 G1 225.01 N 19 12298572 Q187* G A nonsense Het probably null phenotype 07/24/2018
66 528445 UTSW Olfr376 0.000 R6736 G1 225.01 N 11 73375576 V276F G T missense Het probably benign 0.178 phenotype 07/24/2018
67 528421 UTSW Olfr533 0.157 R6736 G1 225.01 N 7 140466887 S229P T C missense Het probably damaging 0.999 phenotype 07/24/2018
68 528422 UTSW Olfr533 0.157 R6736 G1 225.01 N 7 140466921 C240F G T missense Het probably damaging 1.000 phenotype 07/24/2018
69 528455 UTSW Olfr735 0.207 R6736 G1 225.01 N 14 50345448 N300K A T missense Het probably damaging 1.000 phenotype 07/24/2018
70 528433 UTSW Olfr895 0.073 R6736 G1 225.01 N 9 38268570 I19N T A missense Het probably damaging 1.000 phenotype 07/24/2018
71 528434 UTSW Olfr948 0.055 R6736 G1 225.01 N 9 39318793 S274P A G missense Het probably damaging 1.000 phenotype 07/24/2018
72 528458 UTSW Oxct1 1.000 R6736 G1 225.01 N 15 4092417 S283T T A missense Het probably benign 0.000 phenotype 07/24/2018
73 528429 UTSW Pcnx2 0.000 R6736 G1 188.01 N 8 125752317 G T splice site Het probably null phenotype 07/24/2018
74 528430 UTSW Piwil4 0.167 R6736 G1 225.01 N 9 14715823 F424L A G missense Het probably benign 0.000 phenotype 07/24/2018
75 528460 UTSW Pkhd1l1 0.000 R6736 G1 225.01 N 15 44557940 S3035P T C missense Het probably damaging 0.999 0.358 07/24/2018
76 528402 UTSW Psmc2 1.000 R6736 G1 225.01 N 5 21800576 D218E T A missense Het probably damaging 0.992 phenotype 07/24/2018
77 528375 UTSW Ptpn7 0.000 R6736 G1 192.01 N 1 135139236 P277L C T missense Het probably benign 0.009 phenotype 07/24/2018
78 528403 UTSW Rgs12 0.154 R6736 G1 225.01 N 5 35023092 K27E A G missense Het probably damaging 0.999 phenotype 07/24/2018
79 528456 UTSW Rp1l1 0.075 R6736 G1 225.01 N 14 64029724 A920S G T missense Het possibly damaging 0.931 phenotype 07/24/2018
80 528401 UTSW Rsbn1l 0.312 R6736 G1 225.01 N 5 20908224 H433Q A T missense Het probably benign 0.451 07/24/2018
81 528472 UTSW Safb 0.841 R6736 G1 225.01 N 17 56606023 P913Q C A missense Het possibly damaging 0.460 phenotype 07/24/2018
82 528435 UTSW Sema7a 0.323 R6736 G1 225.01 N 9 57960571 V477M G A missense Het probably damaging 1.000 phenotype 07/24/2018
83 528451 UTSW Serpina16 0.053 R6736 G1 225.01 N 12 103668932 T408S T A missense Het possibly damaging 0.831 07/24/2018
84 528414 UTSW Six5 0.783 R6736 G1 156.01 N 7 19094991 V119M G A missense Het possibly damaging 0.826 phenotype 07/24/2018
85 528415 UTSW Slc6a16 0.124 R6736 G1 225.01 N 7 45259028 P11S C T missense Het possibly damaging 0.574 phenotype 07/24/2018
86 528419 UTSW Smg1 1.000 R6736 G1 225.01 N 7 118157166 A G utr 3 prime Het probably benign phenotype 07/24/2018
87 528374 UTSW Sntg1 0.100 R6736 G1 225.01 N 1 8445050 I420F T A missense Het probably benign 0.158 phenotype 07/24/2018
88 528450 UTSW Sptb 0.835 R6736 G1 225.01 N 12 76613180 D982G T C missense Het possibly damaging 0.487 phenotype 07/24/2018
89 528409 UTSW Stag3 0.000 R6736 G1 225.01 N 5 138301499 F891I T A missense Het probably damaging 0.978 phenotype 07/24/2018
90 528427 UTSW Sugp1 0.969 R6736 G1 225.01 N 8 70059303 E183G A G missense Het probably benign 0.437 phenotype 07/24/2018
91 528431 UTSW Taf1d 0.836 R6736 G1 225.01 N 9 15307823 T C critical splice donor site 2 bp Het probably null phenotype 07/24/2018
92 528471 UTSW Tapbp 0.078 R6736 G1 225.01 N 17 33919957 S33P T C missense Het possibly damaging 0.852 phenotype 07/24/2018
93 528393 UTSW Ubap2 0.233 R6736 G1 217.47 N 4 41227210 GCCCGCTTGCCCCGCT GCCCGCTTGCCCCGCTTGCCCCGCT small insertion Het probably benign phenotype 07/24/2018
94 528394 UTSW Ubap2 0.233 R6736 G1 217.47 N 4 41227224 CT CTTGCCCCGGT small insertion Het probably benign phenotype 07/24/2018
95 528469 UTSW Ubash3a 0.000 R6736 G1 225.01 N 17 31231415 T355A A G missense Het probably benign 0.000 phenotype 07/24/2018
96 528464 UTSW Usp16 1.000 R6736 G1 225.01 N 16 87470397 V225G T G missense Het probably damaging 0.996 phenotype 07/24/2018
97 528439 UTSW Utrn 0.000 R6736 G1 225.01 N 10 12621303 V2454A A G missense Het probably benign 0.087 phenotype 07/24/2018
98 528452 UTSW Vmn1r191 0.125 R6736 G1 225.01 N 13 22179550 F11L G T missense Het probably benign 0.139 07/24/2018
99 528468 UTSW Vmn2r117 0.379 R6736 G1 225.01 N 17 23478308 C137S A T missense Het probably damaging 0.994 07/24/2018
100 528418 UTSW Zfp143 0.955 R6736 G1 225.01 N 7 110091814 M524T T C missense Het probably damaging 0.999 phenotype 07/24/2018
[records 1 to 100 of 103] next >> last >|