Incidental Mutations

55 incidental mutations are currently displayed, and affect 55 genes.
11 are Possibly Damaging.
24 are Probably Damaging.
14 are Probably Benign.
6 are Probably Null.
4 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 55 of 55] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 531270 UTSW 1500015O10Rik 0.000 R6776 G1 225.01 N 1 43742391 N144K C A missense Het probably damaging 1.000 phenotype 08/29/2018
2 531322 UTSW 2900011O08Rik 0.131 R6776 G1 225.01 N 16 13986806 S6T T A missense Het possibly damaging 0.942 08/29/2018
3 531296 UTSW Abhd13 0.000 R6776 G1 225.01 N 8 9988075 H224R A G missense Het probably benign 0.029 08/29/2018
4 531297 UTSW Anapc10 0.948 R6776 G1 225.01 N 8 79719745 F68S T C missense Het probably damaging 1.000 phenotype 08/29/2018
5 531318 UTSW Arid2 1.000 R6776 G1 225.01 N 15 96370949 N981S A G missense Het probably benign 0.001 phenotype 08/29/2018
6 531274 UTSW BC055324 1.000 R6776 G1 225.01 N 1 163976749 I338M T C missense Het probably damaging 1.000 08/29/2018
7 531281 UTSW Cfap73 0.484 R6776 G1 225.01 N 5 120634211 F9L A G missense Het probably damaging 0.998 08/29/2018
8 531306 UTSW Chd3 0.000 R6776 G1 225.01 N 11 69354470 L1141V A C missense Het probably damaging 0.999 phenotype 08/29/2018
9 531308 UTSW Daam1 1.000 R6776 G1 225.01 N 12 71989808 L1052F C T missense Het possibly damaging 0.956 phenotype 08/29/2018
10 531323 UTSW Dmxl1 0.954 R6776 G1 225.01 N 18 49893974 R2050C C T missense Het probably damaging 1.000 phenotype 08/29/2018
11 531273 UTSW Dpp10 0.000 R6776 G1 225.01 N 1 123367656 Q552* G A nonsense Het probably null phenotype 08/29/2018
12 531287 UTSW Dysf 0.000 R6776 G1 177.01 N 6 84064894 D160G A G missense Het possibly damaging 0.879 phenotype 08/29/2018
13 531289 UTSW Foxp1 1.000 R6776 G1 124.47 N 6 99075965 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG small deletion Het probably benign phenotype 08/29/2018
14 531305 UTSW Ftcd 0.202 R6776 G1 225.01 N 10 76589239 I518T T C missense Het probably benign 0.094 phenotype 08/29/2018
15 531290 UTSW Gapdh 1.000 R6776 G1 220.01 N 6 125162273 S248P A G missense Het probably damaging 1.000 phenotype 08/29/2018
16 531292 UTSW Gm5592 0.081 R6776 G1 225.01 N 7 41289729 P812A C G missense Het probably damaging 1.000 08/29/2018
17 531304 UTSW Grik2 0.000 R6776 G1 225.01 N 10 49355989 L482F G A missense Het probably damaging 1.000 phenotype 08/29/2018
18 531312 UTSW Gzmg 0.078 R6776 G1 225.01 N 14 56156831 G202D C T missense Het probably damaging 1.000 08/29/2018
19 531283 UTSW Hectd4 0.908 R6776 G1 225.01 N 5 121353511 A3671T G A missense Het possibly damaging 0.845 08/29/2018
20 531299 UTSW Hexa 0.203 R6776 G1 225.01 N 9 59558072 W203C G T missense Het probably damaging 1.000 phenotype 08/29/2018
21 531300 UTSW Igdcc4 0.201 R6776 G1 225.01 N 9 65135418 T1217S A T missense Het probably benign 0.017 08/29/2018
22 531295 UTSW Ipo7 0.959 R6776 G1 225.01 N 7 110047065 D557G A G missense Het probably damaging 0.977 phenotype 08/29/2018
23 531298 UTSW Irx3 0.000 R6776 G1 83.01 N 8 91799835 T414S T A missense Het probably benign 0.005 phenotype 08/29/2018
24 531279 UTSW Jakmip1 0.707 R6776 G1 225.01 N 5 37187154 E1313K G A missense Het probably damaging 0.972 phenotype 08/29/2018
25 531288 UTSW Kbtbd12 0.131 R6776 G1 225.01 N 6 88618266 D194G T C missense Het probably damaging 0.973 08/29/2018
26 531293 UTSW Klk6 0.000 R6776 G1 225.01 N 7 43826874 L46P T C missense Het probably damaging 1.000 phenotype 08/29/2018
27 531321 UTSW Krt86 0.075 R6776 G1 225.01 N 15 101476936 I329T T C missense Het probably benign 0.287 phenotype 08/29/2018
28 531314 UTSW Mroh5 0.060 R6776 G1 108.01 N 15 73789968 A G critical splice donor site 2 bp Het probably null 08/29/2018
29 531313 UTSW Mtrf1 0.108 R6776 G1 225.01 N 14 79413081 V323A T C missense Het probably damaging 1.000 phenotype 08/29/2018
30 531282 UTSW Oas3 0.093 R6776 G1 224.01 N 5 120758874 I894N A T missense Het probably damaging 1.000 phenotype 08/29/2018
31 531315 UTSW Oplah 0.114 R6776 G1 225.01 N 15 76300853 V887I C T missense Het possibly damaging 0.938 phenotype 08/29/2018
32 531276 UTSW Pag1 0.000 R6776 G1 225.01 N 3 9699788 T102A T C missense Het probably benign 0.294 phenotype 08/29/2018
33 531309 UTSW Pcnx 0.000 R6776 G1 225.01 N 12 81962722 A1181V C T missense Het possibly damaging 0.807 phenotype 08/29/2018
34 531317 UTSW Pkdrej 0.082 R6776 G1 225.01 N 15 85817309 Y1475* G T nonsense Het probably null phenotype 08/29/2018
35 531278 UTSW Pla2g5 0.152 R6776 G1 225.01 N 4 138800653 S101P A G missense Het probably benign 0.005 phenotype 08/29/2018
36 531294 UTSW Plekha4 0.105 R6776 G1 225.01 N 7 45534817 A76E C A missense Het probably damaging 1.000 08/29/2018
37 531310 UTSW Plk2 1.000 R6776 G1 225.01 N 13 110399791 I592T T C missense Het probably benign 0.000 phenotype 08/29/2018
38 531302 UTSW Ppp2r3a 0.000 R6776 G1 225.01 N 9 101212862 H87Q A T missense Het probably benign 0.003 phenotype 08/29/2018
39 531307 UTSW Ppp2r3c 0.966 R6776 G1 225.01 N 12 55298467 R79* T A nonsense Het probably null phenotype 08/29/2018
40 531320 UTSW Prpf40b 0.175 R6776 G1 225.01 N 15 99314903 R627W C T missense Het probably damaging 1.000 0.430 phenotype 08/29/2018
41 531286 UTSW Prrt4 0.089 R6776 G1 225.01 N 6 29176552 T258K G T missense Het possibly damaging 0.951 08/29/2018
42 531291 UTSW Rhpn2 0.396 R6776 G1 125.01 N 7 35383769 T A intron Het probably null phenotype 08/29/2018
43 531271 UTSW Slc11a1 0.123 R6776 G1 225.01 N 1 74384085 I365N T A missense Het probably damaging 0.999 phenotype 08/29/2018
44 531311 UTSW Slc7a7 1.000 R6776 G1 225.01 N 14 54374651 G265D C T missense Het possibly damaging 0.948 phenotype 08/29/2018
45 531285 UTSW Thsd7a 0.000 R6776 G1 225.01 N 6 12555637 T83S T A missense Het possibly damaging 0.527 phenotype 08/29/2018
46 531301 UTSW Tln2 0.278 R6776 G1 225.01 N 9 67262905 S1989P A G missense Het probably damaging 1.000 phenotype 08/29/2018
47 531303 UTSW Tnfaip3 0.000 R6776 G1 225.01 N 10 19005576 T321P T G missense Het probably benign 0.018 phenotype 08/29/2018
48 531316 UTSW Tnrc6b 0.235 R6776 G1 225.01 N 15 80924119 P1623L C T missense Het possibly damaging 0.872 phenotype 08/29/2018
49 531269 UTSW Trpa1 0.165 R6776 G1 225.01 N 1 14912377 N85S T C missense Het probably benign 0.000 phenotype 08/29/2018
50 531284 UTSW Trrap 1.000 R6776 G1 174.01 N 5 144851256 R3544* C T nonsense Het probably null phenotype 08/29/2018
51 531277 UTSW Ttf2 0.953 R6776 G1 225.01 N 3 100952553 V695E A T missense Het probably benign 0.015 phenotype 08/29/2018
52 531272 UTSW Ttll4 0.191 R6776 G1 225.01 N 1 74681353 E509G A G missense Het probably damaging 0.996 08/29/2018
53 531319 UTSW Vdr 0.000 R6776 G1 225.01 N 15 97869828 I94V T C missense Het probably damaging 0.998 phenotype 08/29/2018
54 531280 UTSW Wdfy3 0.926 R6776 G1 225.01 N 5 101884045 Q2304K G T missense Het possibly damaging 0.571 phenotype 08/29/2018
55 531275 UTSW Zfp663 0.092 R6776 G1 225.01 N 2 165359015 Y33C T C missense Het probably damaging 1.000 08/29/2018
[records 1 to 55 of 55]