Incidental Mutations

52 incidental mutations are currently displayed, and affect 52 genes.
7 are Possibly Damaging.
18 are Probably Damaging.
22 are Probably Benign.
5 are Probably Null.
0 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 52 of 52] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 532599 UTSW Abca13 0.000 R6791 G1 225.01 Y 11 9378504 C3526S T A missense Het probably damaging 1.000 phenotype 08/29/2018
2 532613 UTSW Adgrf2 0.000 R6791 G1 225.01 Y 17 42710883 N350S T C missense Het probably benign 0.021 0.097 phenotype 08/29/2018
3 532610 UTSW Atp12a 0.000 R6791 G1 225.01 Y 14 56386982 G A critical splice donor site 1 bp Het probably null 0.949 phenotype 08/29/2018
4 532593 UTSW AW551984 0.071 R6791 G1 225.01 Y 9 39600659 S19R T G missense Het probably damaging 0.998 08/29/2018
5 532586 UTSW Bet1l 0.245 R6791 G1 225.01 Y 7 140854505 I77T A G missense Het possibly damaging 0.585 0.089 08/29/2018
6 532572 UTSW Cfap206 0.325 R6791 G1 225.01 Y 4 34711414 I494M T C missense Het possibly damaging 0.764 0.179 08/29/2018
7 532611 UTSW Cog3 1.000 R6791 G1 225.01 Y 14 75730678 I415T A G missense Het probably damaging 0.999 phenotype 08/29/2018
8 532573 UTSW Col15a1 0.075 R6791 G1 225.01 Y 4 47300518 P1060S C T missense Het probably damaging 1.000 0.131 phenotype 08/29/2018
9 532590 UTSW Ctrb1 0.413 R6791 G1 225.01 Y 8 111689349 V71A A G missense Het possibly damaging 0.760 08/29/2018
10 532588 UTSW Ddhd2 0.145 R6791 G1 225.01 Y 8 25752215 Y211C T C missense Het probably benign 0.042 0.150 phenotype 08/29/2018
11 532606 UTSW Fbxl20 0.333 R6791 G1 225.01 Y 11 98109510 T128A T C missense Het probably benign 0.050 0.154 phenotype 08/29/2018
12 532571 UTSW Fdps 0.964 R6791 G1 118.01 Y 3 89095352 A G critical splice donor site 2 bp Het probably null phenotype 08/29/2018
13 532597 UTSW Gm4302 0.504 R6791 G1 132.47 N 10 100341499 TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA unclassified Het probably benign 08/29/2018
14 532617 UTSW Gm8369 0.057 R6791 G1 225.01 Y 19 11511836 T A unclassified Het probably benign 0.090 08/29/2018
15 532600 UTSW Grm6 0.000 R6791 G1 225.01 Y 11 50859774 V588A T C missense Het possibly damaging 0.740 0.183 phenotype 08/29/2018
16 532604 UTSW Heatr6 0.789 R6791 G1 225.01 Y 11 83758341 L174S T C missense Het probably benign 0.000 0.064 08/29/2018
17 532566 UTSW Kif1a 0.895 R6791 G1 225.01 Y 1 93066137 P364S G A missense Het probably damaging 1.000 phenotype 08/29/2018
18 532584 UTSW Klk7 0.068 R6791 G1 225.01 Y 7 43813260 D163G A G missense Het probably benign 0.089 phenotype 08/29/2018
19 532577 UTSW Kmt2e 1.000 R6791 G1 217.47 Y 5 23499476 TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC intron Het probably benign 0.090 phenotype 08/29/2018
20 532567 UTSW Lamb3 0.142 R6791 G1 225.01 Y 1 193334861 S787P T C missense Het possibly damaging 0.925 phenotype 08/29/2018
21 532616 UTSW Lrp5 0.918 R6791 G1 222.01 Y 19 3600753 C1227Y C T missense Het probably damaging 1.000 0.970 phenotype 08/29/2018
22 532582 UTSW Mgst1 0.148 R6791 G1 225.01 Y 6 138141807 G A intron Het probably benign phenotype 08/29/2018
23 532605 UTSW Mllt6 0.000 R6791 G1 184.01 Y 11 97680602 S1022P T C missense Het probably damaging 0.975 0.059 phenotype 08/29/2018
24 532591 UTSW Mtmr2 0.387 R6791 G1 225.01 Y 9 13805382 I521T T C missense Het probably benign 0.016 phenotype 08/29/2018
25 532592 UTSW Naalad2 0.388 R6791 G1 225.01 Y 9 18385130 T75A T C missense Het possibly damaging 0.672 phenotype 08/29/2018
26 532587 UTSW Nadsyn1 0.000 R6791 G1 225.01 Y 7 143819108 I83N A T missense Het probably damaging 0.999 0.951 phenotype 08/29/2018
27 532608 UTSW Naip2 0.097 R6791 G1 225.01 N 13 100154960 S1157G T C missense Het probably benign 0.000 phenotype 08/29/2018
28 532603 UTSW Neurl4 0.000 R6791 G1 225.01 Y 11 69908510 L904Q T A missense Het probably damaging 1.000 0.697 phenotype 08/29/2018
29 532596 UTSW Ngp 0.000 R6791 G1 225.01 Y 9 110419949 I30L A C missense Het probably benign 0.015 08/29/2018
30 532602 UTSW Olfr312 0.358 R6791 G1 225.01 Y 11 58832077 Y308H T C missense Het probably benign 0.000 phenotype 08/29/2018
31 532598 UTSW Olfr787 0.060 R6791 G1 225.01 Y 10 129463154 M159I G A missense Het probably benign 0.001 phenotype 08/29/2018
32 532574 UTSW Orm2 0.048 R6791 G1 225.01 Y 4 63363959 M125L A T missense Het probably benign 0.001 0.090 08/29/2018
33 532618 UTSW Pax2 1.000 R6791 G1 225.01 Y 19 44788821 D151V A T missense Het possibly damaging 0.690 0.075 phenotype 08/29/2018
34 532585 UTSW Polg 1.000 R6791 G1 225.01 Y 7 79460109 V382A A G missense Het probably benign 0.255 phenotype 08/29/2018
35 532615 UTSW Ppargc1b 0.347 R6791 G1 225.01 Y 18 61307676 G724W C A missense Het probably damaging 0.999 phenotype 08/29/2018
36 532576 UTSW Pramef6 0.048 R6791 G1 225.01 Y 4 143895682 I368F T A missense Het probably benign 0.020 0.090 08/29/2018
37 532607 UTSW Prss16 0.000 R6791 G1 221.01 Y 13 22006067 V307E A T missense Het probably damaging 0.990 0.826 phenotype 08/29/2018
38 532589 UTSW Prss54 0.070 R6791 G1 88.01 Y 8 95564655 T G splice site Het probably null phenotype 08/29/2018
39 532575 UTSW Rspo1 0.000 R6791 G1 178.01 Y 4 125007183 H108R A G missense Het probably benign 0.009 0.058 phenotype 08/29/2018
40 532601 UTSW Sh3bp5l 0.093 R6791 G1 166.01 Y 11 58346272 H352N C A missense Het probably damaging 0.986 08/29/2018
41 532594 UTSW Skor1 0.406 R6791 G1 179.01 Y 9 63140354 T C splice site 3 bp Het probably null 08/29/2018
42 532595 UTSW Smad6 0.695 R6791 G1 225.01 Y 9 64012227 Y289H A G missense Het probably benign 0.000 phenotype 08/29/2018
43 532568 UTSW Spg11 0.192 R6791 G1 225.01 Y 2 122093443 E799G T C missense Het probably damaging 0.994 0.120 phenotype 08/29/2018
44 532569 UTSW Spg20 0.253 R6791 G1 225.01 Y 3 55127561 G456D G A missense Het probably damaging 1.000 phenotype 08/29/2018
45 532612 UTSW Tbc1d4 0.000 R6791 G1 114.01 Y 14 101608259 K68Q T G missense Het probably damaging 0.981 0.081 phenotype 08/29/2018
46 532614 UTSW Treml2 0.062 R6791 G1 225.01 Y 17 48309219 M296V A G missense Het probably benign 0.240 phenotype 08/29/2018
47 532580 UTSW Ugt2b1 0.104 R6791 G1 225.01 Y 5 86919257 D436Y C A missense Het probably damaging 1.000 phenotype 08/29/2018
48 532619 UTSW Usp9y 0.064 R6791 G1 222 Y Y 1325042 A T splice site Homo probably null phenotype 08/29/2018
49 532570 UTSW Vmn2r6 0.101 R6791 G1 225.01 Y 3 64538159 Y626C T C missense Het probably damaging 1.000 08/29/2018
50 532581 UTSW Xpc 0.421 R6791 G1 225.01 Y 6 91506857 A169V G A missense Het probably benign 0.006 phenotype 08/29/2018
51 532609 UTSW Zfp131 0.963 R6791 G1 225.01 Y 13 119766593 V506A A G missense Het probably damaging 0.978 0.172 phenotype 08/29/2018
52 532583 UTSW Zfp74 0.086 R6791 G1 225.01 Y 7 29934435 I616T A G missense Het probably benign 0.018 08/29/2018
[records 1 to 52 of 52]