Incidental Mutations

48 incidental mutations are currently displayed, and affect 48 genes.
8 are Possibly Damaging.
17 are Probably Damaging.
18 are Probably Benign.
5 are Probably Null.
2 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 48 of 48] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 533341 UTSW Adam3 0.000 R6801 G1 225.01 Y 8 24684664 Y695F T A missense Het possibly damaging 0.607 phenotype 09/12/2018
2 533345 UTSW Arhgap20 0.353 R6801 G1 225.01 Y 9 51848592 D545G A G missense Het probably damaging 1.000 phenotype 09/12/2018
3 533329 UTSW Arhgef11 0.000 R6801 G1 225.01 Y 3 87735852 E1457G A G missense Het possibly damaging 0.532 phenotype 09/12/2018
4 533316 UTSW Atp2b4 0.441 R6801 G1 225.01 Y 1 133727786 I747F T A missense Het probably damaging 0.967 0.164 phenotype 09/12/2018
5 533327 UTSW Bche 0.000 R6801 G1 225.01 Y 3 73701800 I98L T A missense Het probably benign 0.000 phenotype 09/12/2018
6 533314 UTSW C2cd6 0.051 R6801 G1 217.47 Y 1 59094583 TC T frame shift Het probably null 09/12/2018
7 533339 UTSW Ccdc90b 0.079 R6801 G1 225.01 Y 7 92567735 T72A A G missense Het probably benign 0.001 0.058 09/12/2018
8 533354 UTSW Chrd 1.000 R6801 G1 225.01 Y 16 20735747 E352G A G missense Het possibly damaging 0.679 phenotype 09/12/2018
9 533333 UTSW Csmd2 0.152 R6801 G1 225.01 Y 4 128383950 E953G A G missense Het probably benign 0.114 0.157 09/12/2018
10 533328 UTSW Dchs2 0.418 R6801 G1 129.01 Y 3 83128534 M196K T A missense Het probably benign 0.003 09/12/2018
11 533346 UTSW Ddx10 0.963 R6801 G1 225.01 Y 9 53247907 Q33* G A nonsense Het probably null 0.976 phenotype 09/12/2018
12 533330 UTSW Dennd4b 0.164 R6801 G1 225.01 Y 3 90268779 V201E T A missense Het probably damaging 0.975 09/12/2018
13 533358 UTSW Fbn2 0.911 R6801 G1 225.01 Y 18 58113348 H494L T A missense Het probably benign 0.039 phenotype 09/12/2018
14 533347 UTSW Fbxw13 0.065 R6801 G1 225.01 Y 9 109194727 A83V G A missense Het probably null 1.000 09/12/2018
15 533326 UTSW Fxr1 1.000 R6801 G1 225.01 Y 3 34054303 D321G A G missense Het possibly damaging 0.646 phenotype 09/12/2018
16 533357 UTSW Galm 0.084 R6801 G1 225.01 Y 17 80181624 H233R A G missense Het probably benign 0.009 0.059 phenotype 09/12/2018
17 533337 UTSW Gm7298 0.216 R6801 G1 120.01 Y 6 121775809 T837A A G missense Het probably benign 0.031 0.090 09/12/2018
18 533315 UTSW Gmppa 0.502 R6801 G1 225.01 Y 1 75441747 S258C C G missense Het possibly damaging 0.945 0.416 phenotype 09/12/2018
19 533348 UTSW Hk1 0.463 R6801 G1 225.01 Y 10 62281131 E645A T G missense Het probably damaging 0.966 phenotype 09/12/2018
20 533336 UTSW Igkv1-132 0.153 R6801 G1 225.01 Y 6 67760340 T97A A G missense Het probably damaging 0.991 09/12/2018
21 533338 UTSW Kcnc1 0.336 R6801 G1 225.01 Y 7 46435292 F547L T C missense Het probably damaging 0.986 phenotype 09/12/2018
22 533325 UTSW Lama5 1.000 R6801 G1 225.01 Y 2 180191662 P1519L G A missense Het probably damaging 1.000 0.428 phenotype 09/12/2018
23 533331 UTSW Lingo2 0.121 R6801 G1 225.01 Y 4 35709566 E138V T A missense Het probably damaging 0.973 09/12/2018
24 543647 UTSW Myb 1.000 R6801 G1 225.01 Y 10 21144966 T C splice site 3 bp Het probably null phenotype 04/22/2019
25 533312 UTSW Mybl1 0.667 R6801 G1 225.01 Y 1 9683128 V243A A G missense Het probably benign 0.421 phenotype 09/12/2018
26 533351 UTSW Mylk4 0.000 R6801 G1 225.01 Y 13 32728410 S189N C T missense Het probably benign 0.074 09/12/2018
27 533320 UTSW Olfr1133 0.063 R6801 G1 225.01 Y 2 87645323 Y267H A G missense Het probably benign 0.231 phenotype 09/12/2018
28 533321 UTSW Olfr1267-ps1 0.271 R6801 G1 225.01 Y 2 90085609 I284N A T missense Het probably damaging 1.000 09/12/2018
29 533323 UTSW Olfr1283 0.529 R6801 G1 225.01 Y 2 111369049 Q139L A T missense Het probably benign 0.216 phenotype 09/12/2018
30 533349 UTSW Olfr1388 0.073 R6801 G1 225.01 Y 11 49444342 M164V A G missense Het probably benign 0.103 phenotype 09/12/2018
31 533332 UTSW Olfr155 0.057 R6801 G1 225.01 Y 4 43855206 L299* T A nonsense Het probably null phenotype 09/12/2018
32 533342 UTSW Olfr27 0.062 R6801 G1 225.01 Y 9 39144210 I37F A T missense Het probably benign 0.014 phenotype 09/12/2018
33 533350 UTSW Oxld1 0.069 R6801 G1 225.01 Y 11 120456824 D182E A T missense Het probably damaging 1.000 0.370 09/12/2018
34 533334 UTSW Phf13 0.197 R6801 G1 225.01 Y 4 151991560 L295Q A T missense Het probably damaging 0.999 phenotype 09/12/2018
35 533317 UTSW Prrc2c 0.560 R6801 G1 217.47 Y 1 162709061 TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC unclassified Het probably benign 0.090 09/12/2018
36 533356 UTSW Prss33 0.058 R6801 G1 210.01 Y 17 23834839 L88P A G missense Het possibly damaging 0.878 0.179 09/12/2018
37 533319 UTSW Ralgds 0.198 R6801 G1 225.01 Y 2 28548436 Y596C A G missense Het probably damaging 1.000 0.818 phenotype 09/12/2018
38 533313 UTSW Rftn2 0.000 R6801 G1 201.01 Y 1 55194259 I379T A G missense Het possibly damaging 0.906 09/12/2018
39 533344 UTSW Rnf214 0.815 R6801 G1 225.01 Y 9 45896105 E267K C T missense Het probably damaging 0.999 09/12/2018
40 533353 UTSW Rpp14 0.949 R6801 G1 225.01 Y 14 8083717 T C start gained Het probably benign 0.090 09/12/2018
41 533324 UTSW Rpusd2 0.000 R6801 G1 225.01 Y 2 119035395 Y191C A G missense Het probably damaging 1.000 09/12/2018
42 533352 UTSW Serpinb9c 0.000 R6801 G1 225.01 Y 13 33157824 M1L T A start codon destroyed Het probably benign 0.005 09/12/2018
43 533335 UTSW Shroom3 1.000 R6801 G1 225.01 Y 5 92940936 D434G A G missense Het probably damaging 1.000 phenotype 09/12/2018
44 533359 UTSW Smc5 1.000 R6801 G1 225.01 Y 19 23214646 S888L G A missense Het probably benign 0.337 phenotype 09/12/2018
45 533318 UTSW Suv39h2 0.000 R6801 G1 225.01 Y 2 3464421 R299K C T missense Het probably benign 0.158 0.075 phenotype 09/12/2018
46 533343 UTSW Trappc4 0.962 R6801 G1 225.01 Y 9 44404388 I176N A T missense Het probably damaging 0.964 0.786 09/12/2018
47 533340 UTSW Trim12c 0.072 R6801 G1 225.01 Y 7 104348130 V73E A T missense Het probably damaging 1.000 0.860 09/12/2018
48 533355 UTSW Vmn2r111 0.100 R6801 G1 225.01 Y 17 22559051 N549S T C missense Het possibly damaging 0.502 0.179 09/12/2018
[records 1 to 48 of 48]