Incidental Mutations

65 incidental mutations are currently displayed, and affect 65 genes.
15 are Possibly Damaging.
21 are Probably Damaging.
23 are Probably Benign.
6 are Probably Null.
3 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 65 of 65] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 537655 UTSW Acsl5 0.000 R6821 G1 225.01 Y 19 55288836 I417T T C missense Het probably benign 0.033 phenotype 10/18/2018
2 537645 UTSW Adamts12 0.092 R6821 G1 225.01 Y 15 11152048 K208T A C missense Het probably benign 0.145 0.102 phenotype 10/18/2018
3 537629 UTSW Adamts8 0.069 R6821 G1 225.01 Y 9 30956626 L582Q T A missense Het probably benign 0.078 phenotype 10/18/2018
4 537600 UTSW Aim2 0.061 R6821 G1 225.01 Y 1 173463980 T317R C G missense Het probably damaging 0.998 0.641 phenotype 10/18/2018
5 537624 UTSW Ano9 0.062 R6821 G1 225.01 Y 7 141107256 F357I A T missense Het possibly damaging 0.696 phenotype 10/18/2018
6 537593 UTSW Aox3 0.000 R6821 G1 225.01 Y 1 58150388 V416A T C missense Het probably benign 0.037 10/18/2018
7 537602 UTSW Arhgap21 0.400 R6821 G1 225.01 Y 2 20848848 F1901C A C missense Het probably benign 0.000 phenotype 10/18/2018
8 537609 UTSW Atp8b2 0.281 R6821 G1 225.01 Y 3 89948173 F506I A T missense Het probably damaging 0.987 0.270 phenotype 10/18/2018
9 537652 UTSW Atp9b 0.085 R6821 G1 225.01 Y 18 80847248 L292H A T missense Het probably damaging 1.000 10/18/2018
10 537619 UTSW C2cd5 0.432 R6821 G1 225.01 Y 6 143017986 V891A A G missense Het probably damaging 0.997 0.113 10/18/2018
11 537597 UTSW Ccnt2 1.000 R6821 G1 225.01 Y 1 127803335 S650P T C missense Het probably damaging 0.990 0.103 phenotype 10/18/2018
12 537637 UTSW Cdhr3 0.056 R6821 G1 225.01 Y 12 33035045 N791Y T A missense Het probably damaging 1.000 10/18/2018
13 540722 UTSW Cmtm1 0.389 R6821 G1 214.46 N 8 104309702 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG frame shift Het probably null 11/16/2018
14 537606 UTSW D630003M21Rik 0.068 R6821 G1 225.01 Y 2 158204774 L761R A C missense Het probably damaging 1.000 10/18/2018
15 537614 UTSW Draxin 0.084 R6821 G1 225.01 Y 4 148115691 Q101K G T missense Het possibly damaging 0.584 phenotype 10/18/2018
16 537648 UTSW Dtx3l 0.443 R6821 G1 225.01 Y 16 35933060 L392Q A T missense Het probably damaging 1.000 phenotype 10/18/2018
17 537647 UTSW Eif3d 0.970 R6821 G1 225.01 Y 15 77961655 S389P A G missense Het possibly damaging 0.928 phenotype 10/18/2018
18 537649 UTSW Enpp5 0.000 R6821 G1 225.01 Y 17 44085264 G356S G A missense Het probably damaging 1.000 0.917 phenotype 10/18/2018
19 537595 UTSW Epha4 0.944 R6821 G1 225.01 Y 1 77382945 N757S T C missense Het possibly damaging 0.885 0.255 phenotype 10/18/2018
20 537636 UTSW Fam228b 0.083 R6821 G1 225.01 Y 12 4763083 I96V T C missense Het probably benign 0.081 10/18/2018
21 537618 UTSW Gars 1.000 R6821 G1 225.01 Y 6 55079338 E728G A G missense Het probably benign 0.002 0.089 phenotype 10/18/2018
22 537630 UTSW Gldn 0.320 R6821 G1 225.01 Y 9 54338770 M535T T C missense Het probably benign 0.010 phenotype 10/18/2018
23 537613 UTSW Gm13089 0.072 R6821 G1 225.01 Y 4 143699304 L23* A T nonsense Het probably null 10/18/2018
24 537598 UTSW Gm47985 0.294 R6821 G1 225.01 Y 1 151183036 T143A A G missense Het possibly damaging 0.659 10/18/2018
25 537632 UTSW Gpr6 0.000 R6821 G1 225.01 Y 10 41071008 T193A T C missense Het probably benign 0.035 phenotype 10/18/2018
26 537620 UTSW Grik5 0.220 R6821 G1 225.01 Y 7 25046355 R431Q C T missense Het possibly damaging 0.456 phenotype 10/18/2018
27 537638 UTSW Hecw1 0.000 R6821 G1 225.01 Y 13 14264134 Y1315F T A missense Het probably damaging 0.998 10/18/2018
28 537623 UTSW Hs3st2 0.000 R6821 G1 225.01 Y 7 121500522 D197G A G missense Het possibly damaging 0.942 phenotype 10/18/2018
29 537599 UTSW Igsf9 0.000 R6821 G1 225.01 Y 1 172484493 I2T T C missense Het probably benign 0.390 phenotype 10/18/2018
30 537641 UTSW Ints9 1.000 R6821 G1 225.01 Y 14 65037458 E621G A G missense Het probably benign 0.201 0.240 phenotype 10/18/2018
31 537642 UTSW Itm2b 0.261 R6821 G1 225.01 Y 14 73366467 P47S G A missense Het probably benign 0.001 phenotype 10/18/2018
32 537628 UTSW Map10 0.081 R6821 G1 225.01 Y 8 125670399 K177R A G missense Het probably benign 0.011 10/18/2018
33 537616 UTSW Mdh2 1.000 R6821 G1 225.01 Y 5 135789671 F260S T C missense Het possibly damaging 0.487 phenotype 10/18/2018
34 537610 UTSW Mtmr11 0.161 R6821 G1 225.01 Y 3 96170407 T573A A G missense Het probably benign 0.000 0.090 10/18/2018
35 537643 UTSW Mycbp2 1.000 R6821 G1 225.01 Y 14 103139409 I3812N A T missense Het probably damaging 0.996 phenotype 10/18/2018
36 537634 UTSW Myo15 0.000 R6821 G1 225.01 Y 11 60524475 N3403S A G missense Het probably damaging 0.999 phenotype 10/18/2018
37 537601 UTSW Nvl 0.962 R6821 G1 225.01 Y 1 181126970 Q343* G A nonsense Het probably null phenotype 10/18/2018
38 537607 UTSW Ocstamp 0.000 R6821 G1 225.01 Y 2 165397922 S115T A T missense Het probably benign 0.004 phenotype 10/18/2018
39 537621 UTSW Olfr632 0.055 R6821 G1 225.01 Y 7 103937586 I69F A T missense Het probably benign 0.070 phenotype 10/18/2018
40 537622 UTSW Otoa 0.000 R6821 G1 225.01 Y 7 121092847 G A critical splice donor site 1 bp Het probably null phenotype 10/18/2018
41 537651 UTSW Pcdhb20 0.074 R6821 G1 225.01 Y 18 37506122 N567I A T missense Het probably damaging 1.000 0.247 phenotype 10/18/2018
42 537654 UTSW Pgm5 0.201 R6821 G1 210.01 Y 19 24861647 V48E A T missense Het possibly damaging 0.878 phenotype 10/18/2018
43 537596 UTSW Phlpp1 0.184 R6821 G1 225.01 Y 1 106386444 S1182R T A missense Het probably damaging 0.978 0.088 phenotype 10/18/2018
44 537631 UTSW Pik3r4 1.000 R6821 G1 225.01 Y 9 105650606 L386Q T A missense Het probably damaging 0.977 0.773 phenotype 10/18/2018
45 537646 UTSW Pop1 0.959 R6821 G1 225.01 Y 15 34508639 K287E A G missense Het possibly damaging 0.858 0.124 phenotype 10/18/2018
46 537611 UTSW Rad54b 0.000 R6821 G1 225.01 Y 4 11612777 D803G A G missense Het probably damaging 1.000 phenotype 10/18/2018
47 537644 UTSW Rbm26 0.690 R6821 G1 225.01 Y 14 105116964 G A intron Het probably benign 10/18/2018
48 537626 UTSW Rspry1 0.526 R6821 G1 225.01 Y 8 94635431 Q113* C T nonsense Het probably null phenotype 10/18/2018
49 537608 UTSW Siah2 0.000 R6821 G1 225.01 N 3 58691770 S16C T A missense Het probably benign 0.226 phenotype 10/18/2018
50 537605 UTSW Sirpa 0.000 R6821 G1 225.01 Y 2 129630097 D481E C A missense Het probably damaging 1.000 phenotype 10/18/2018
51 537627 UTSW Slc38a7 0.245 R6821 G1 225.01 Y 8 95844920 D227E A C missense Het probably benign 0.255 0.077 10/18/2018
52 537653 UTSW Smc5 1.000 R6821 G1 225.01 Y 19 23242787 V438A A G missense Het probably benign 0.198 phenotype 10/18/2018
53 537650 UTSW Spast 0.000 R6821 G1 225.01 Y 17 74351962 E108G A G missense Het probably benign 0.017 phenotype 10/18/2018
54 537594 UTSW Speg 1.000 R6821 G1 225.01 Y 1 75417903 E1752G A G missense Het possibly damaging 0.828 phenotype 10/18/2018
55 537635 UTSW Tanc2 1.000 R6821 G1 225.01 Y 11 105886490 T G splice site 24 bp Het probably null phenotype 10/18/2018
56 537639 UTSW Tgfbi 0.117 R6821 G1 225.01 Y 13 56626137 I243T T C missense Het possibly damaging 0.951 phenotype 10/18/2018
57 537612 UTSW Tlr12 0.000 R6821 G1 225.01 Y 4 128616892 S522G T C missense Het possibly damaging 0.955 phenotype 10/18/2018
58 537640 UTSW Trav14-3 0.497 R6821 G1 225.01 Y 14 53763472 I47V A G missense Het probably benign 0.069 0.090 10/18/2018
59 537617 UTSW Tsc22d4 0.000 R6821 G1 225.01 Y 5 137762644 V109A T C missense Het possibly damaging 0.922 phenotype 10/18/2018
60 537604 UTSW Ttl 1.000 R6821 G1 225.01 Y 2 129068915 R73H G A missense Het probably damaging 0.999 phenotype 10/18/2018
61 537633 UTSW Usp34 0.770 R6821 G1 225.01 Y 11 23367491 T850I C T missense Het possibly damaging 0.787 10/18/2018
62 537625 UTSW Vdac3 0.456 R6821 G1 225.01 Y 8 22580475 Y140C T C missense Het probably damaging 0.997 phenotype 10/18/2018
63 543638 UTSW Vmn2r120 0.076 R6821 G1 73.01 Y 17 57536659 R62G T C missense Het probably benign 0.001 04/12/2019
64 537615 UTSW Vmn2r17 0.097 R6821 G1 225.01 Y 5 109429465 Y461N T A missense Het probably damaging 0.997 10/18/2018
65 537603 UTSW Wt1 1.000 R6821 G1 225.01 Y 2 105172267 F493I T A missense Het probably damaging 1.000 phenotype 10/18/2018
[records 1 to 65 of 65]