Incidental Mutations

64 incidental mutations are currently displayed, and affect 64 genes.
7 are Possibly Damaging.
22 are Probably Damaging.
27 are Probably Benign.
5 are Probably Null.
0 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 64 of 64] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 536105 UTSW Ankdd1b 0.083 R6869 G1 225.01 Y 13 96444291 N166K A T missense Het possibly damaging 0.770 10/18/2018
2 536061 UTSW Arhgap30 0.000 R6869 G1 225.01 Y 1 171409055 R999L G T missense Het probably damaging 1.000 10/18/2018
3 536071 UTSW Bnc2 1.000 R6869 G1 225.01 Y 4 84293496 D212V T A missense Het probably damaging 0.998 phenotype 10/18/2018
4 536065 UTSW Bpifb5 0.000 R6869 G1 225.01 Y 2 154233223 I357T T C missense Het probably benign 0.332 10/18/2018
5 536103 UTSW Catsperb 0.069 R6869 G1 225.01 Y 12 101480737 F208S T C missense Het probably benign 0.088 10/18/2018
6 536120 UTSW Cc2d2b 0.100 R6869 G1 225.01 Y 19 40809454 H1105Q T A missense Het probably benign 0.065 0.053 10/18/2018
7 543682 UTSW Chchd6 0.070 R6869 G1 41.01 Y 6 89595496 D17G T C missense Het probably damaging 1.000 05/08/2019
8 536066 UTSW Chd6 0.737 R6869 G1 225.01 Y 2 160965730 S1855G T C missense Het probably benign 0.000 phenotype 10/18/2018
9 536088 UTSW Cpe 0.000 R6869 G1 225.01 Y 8 64619427 V143A A G missense Het probably benign 0.085 0.048 phenotype 10/18/2018
10 536082 UTSW Cyfip1 1.000 R6869 G1 225.01 Y 7 55907365 V770D T A missense Het possibly damaging 0.726 phenotype 10/18/2018
11 536092 UTSW Cyp1a1 0.103 R6869 G1 225.01 Y 9 57702784 M494L A T missense Het probably benign 0.000 0.056 phenotype 10/18/2018
12 536109 UTSW Dcstamp 0.535 R6869 G1 225.01 Y 15 39754458 S88P T C missense Het probably damaging 1.000 phenotype 10/18/2018
13 536100 UTSW Dnah2 0.000 R6869 G1 225.01 Y 11 69429471 N3924I T A missense Het probably damaging 1.000 phenotype 10/18/2018
14 536064 UTSW F830045P16Rik 0.075 R6869 G1 225.01 Y 2 129474561 E76G T C missense Het probably damaging 0.988 10/18/2018
15 536110 UTSW Fam91a1 0.000 R6869 G1 225.01 Y 15 58431268 V342E T A missense Het probably benign 0.003 phenotype 10/18/2018
16 536062 UTSW Fastkd1 0.403 R6869 G1 225.01 Y 2 69702760 A421V G A missense Het probably benign 0.017 10/18/2018
17 536086 UTSW Fgf20 0.000 R6869 G1 225.01 Y 8 40281148 Y64C T C missense Het probably damaging 0.983 0.198 phenotype 10/18/2018
18 536102 UTSW Gen1 0.145 R6869 G1 225.01 Y 12 11241441 N847K A T missense Het probably benign 0.016 phenotype 10/18/2018
19 536073 UTSW Gm438 0.054 R6869 G1 225.01 Y 4 144780472 A T critical splice donor site 2 bp Het probably null 10/18/2018
20 536095 UTSW Gm4922 0.000 R6869 G1 225.01 Y 10 18784515 I153K A T missense Het probably damaging 0.996 0.026 10/18/2018
21 536079 UTSW Gm6619 0.090 R6869 G1 225.01 Y 6 131486438 I6T T C missense Het unknown 10/18/2018
22 536118 UTSW H2-Ab1 0.061 R6869 G1 225.01 Y 17 34267563 Y199H T C missense Het probably damaging 0.999 phenotype 10/18/2018
23 536112 UTSW Hdac7 1.000 R6869 G1 225.01 Y 15 97796176 L737F C A missense Het probably damaging 1.000 phenotype 10/18/2018
24 536119 UTSW Hells 1.000 R6869 G1 225.01 Y 19 38940635 N121D A G missense Het probably benign 0.079 0.172 phenotype 10/18/2018
25 536106 UTSW Itga2 0.000 R6869 G1 225.01 N 13 114875537 G A synonymous Het probably null phenotype 10/18/2018
26 536091 UTSW Itgb1 1.000 R6869 G1 225.01 Y 8 128720035 D391G A G missense Het probably benign 0.012 phenotype 10/18/2018
27 536068 UTSW Lama5 1.000 R6869 G1 225.01 Y 2 180191662 P1519L G A missense Het probably damaging 1.000 0.200 phenotype 10/18/2018
28 536121 UTSW Lbx1 0.871 R6869 G1 225.01 Y 19 45234951 S93C T A missense Het probably damaging 0.998 0.298 phenotype 10/18/2018
29 536077 UTSW Lmod2 0.117 R6869 G1 225.01 Y 6 24604127 M367T T C missense Het probably benign 0.064 0.142 phenotype 10/18/2018
30 536075 UTSW Lrrc43 0.068 R6869 G1 225.01 Y 5 123504276 G A critical splice donor site 1 bp Het probably null 10/18/2018
31 536083 UTSW Man2a2 0.400 R6869 G1 225.01 Y 7 80362945 G574D C T missense Het probably benign 0.354 phenotype 10/18/2018
32 536098 UTSW Mier2 0.244 R6869 G1 225.01 Y 10 79542669 K343T T G missense Het probably damaging 0.989 10/18/2018
33 543683 UTSW Msh5 0.000 R6869 G1 58.01 Y 17 35041834 A T intron 264 bp Het probably null phenotype 05/08/2019
34 536087 UTSW Mtus1 0.227 R6869 G1 225.01 Y 8 41082654 Q675R T C missense Het possibly damaging 0.708 0.103 phenotype 10/18/2018
35 536089 UTSW Ncan 0.000 R6869 G1 225.01 Y 8 70107907 H803Q A T missense Het probably benign 0.078 0.119 phenotype 10/18/2018
36 536113 UTSW Nckap5l 0.276 R6869 G1 180.01 Y 15 99426453 V723A A G missense Het probably damaging 0.998 10/18/2018
37 536116 UTSW Nectin3 0.332 R6869 G1 225.01 Y 16 46395143 R79C G A missense Het probably damaging 0.964 phenotype 10/18/2018
38 536090 UTSW Nlrc5 0.000 R6869 G1 225.01 Y 8 94521955 E1735G A G missense Het probably benign 0.002 phenotype 10/18/2018
39 536114 UTSW Nrros 0.000 R6869 G1 225.01 Y 16 32144431 L220S A G missense Het probably damaging 1.000 phenotype 10/18/2018
40 536063 UTSW Olfr1107 0.070 R6869 G1 225.01 Y 2 87071673 I154F T A missense Het probably benign 0.110 phenotype 10/18/2018
41 536085 UTSW Olfr584 0.061 R6869 G1 225.01 Y 7 103085868 V112M G A missense Het possibly damaging 0.469 phenotype 10/18/2018
42 536107 UTSW Oxa1l 1.000 R6869 G1 225.01 Y 14 54366738 P152S C T missense Het probably damaging 1.000 phenotype 10/18/2018
43 536094 UTSW Pdcd6ip 0.000 R6869 G1 225.01 Y 9 113655106 Y818H A G missense Het unknown 0.354 phenotype 10/18/2018
44 536093 UTSW Pik3cb 0.962 R6869 G1 225.01 Y 9 99060259 S682T A T missense Het probably benign 0.082 phenotype 10/18/2018
45 536076 UTSW Ppp1r3a 0.000 R6869 G1 225.01 Y 6 14754826 S141A A C missense Het probably benign 0.393 phenotype 10/18/2018
46 536060 UTSW Prrc2c 0.339 R6869 G1 217.47 Y 1 162709061 TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC unclassified Het probably benign 0.085 10/18/2018
47 536096 UTSW Ptprk 0.000 R6869 G1 225.01 Y 10 28473059 T C critical splice donor site 2 bp Het probably null 0.536 phenotype 10/18/2018
48 536099 UTSW Ranbp17 0.000 R6869 G1 225.01 Y 11 33513074 T C start gained Het probably benign phenotype 10/18/2018
49 536108 UTSW Rcbtb1 0.298 R6869 G1 225.01 Y 14 59217602 V95A T C missense Het probably benign 0.007 0.162 phenotype 10/18/2018
50 536101 UTSW Retreg3 0.000 R6869 G1 174.01 Y 11 101119818 G A start gained Het probably benign 0.103 10/18/2018
51 536097 UTSW Rhobtb1 0.214 R6869 G1 225.01 Y 10 69270226 L207P T C missense Het probably damaging 0.988 phenotype 10/18/2018
52 536084 UTSW Rsf1 1.000 R6869 G1 217.47 N 7 97579906 GGCG GGCGACGGCTGCG unclassified Het probably benign phenotype 10/18/2018
53 536117 UTSW Sh3bgr 0.163 R6869 G1 225.01 Y 16 96206660 Y75C A G missense Het probably damaging 1.000 10/18/2018
54 536069 UTSW Strip1 0.966 R6869 G1 225.01 Y 3 107613445 D763G T C missense Het probably damaging 0.998 phenotype 10/18/2018
55 536115 UTSW Stxbp5l 0.000 R6869 G1 225.01 Y 16 37204448 V596E A T missense Het possibly damaging 0.740 phenotype 10/18/2018
56 536078 UTSW Tas2r138 0.000 R6869 G1 225.01 Y 6 40612421 I297T A G missense Het probably damaging 1.000 0.318 phenotype 10/18/2018
57 536070 UTSW Topors 0.509 R6869 G1 225.01 Y 4 40261201 N694K A C missense Het unknown phenotype 10/18/2018
58 536111 UTSW Tymp 0.000 R6869 G1 225.01 Y 15 89376691 R20G T C missense Het probably benign 0.000 0.100 phenotype 10/18/2018
59 536072 UTSW Ubr4 1.000 R6869 G1 225.01 Y 4 139467227 T1144A A G missense Het possibly damaging 0.928 phenotype 10/18/2018
60 536104 UTSW Unc79 1.000 R6869 G1 225.01 Y 12 103113072 Q1636L A T missense Het probably benign 0.332 phenotype 10/18/2018
61 536081 UTSW Vmn1r78 0.072 R6869 G1 225.01 N 7 12152749 M96V A G missense Het probably benign 0.007 10/18/2018
62 536067 UTSW Wfdc8 0.000 R6869 G1 225.01 Y 2 164599092 D244N C T missense Het possibly damaging 0.822 phenotype 10/18/2018
63 536074 UTSW Zbtb49 0.087 R6869 G1 225.01 Y 5 38214350 N62K G T missense Het probably damaging 0.999 10/18/2018
64 536080 UTSW Zfp579 0.000 R6869 G1 225.01 Y 7 4994461 D150E G T missense Het probably benign 0.001 10/18/2018
[records 1 to 64 of 64]