Incidental Mutations

39 incidental mutations are currently displayed, and affect 39 genes.
7 are Possibly Damaging.
16 are Probably Damaging.
14 are Probably Benign.
2 are Probably Null.
0 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 39 of 39] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 538824 UTSW Adat1 0.125 R6907 G1 225.01 Y 8 111972161 I344V T C missense Het probably benign 0.000 phenotype 11/06/2018
2 538826 UTSW Bmper 1.000 R6907 G1 225.01 Y 9 23399572 Q434L A T missense Het probably damaging 1.000 phenotype 11/06/2018
3 538842 UTSW Cabyr 0.080 R6907 G1 225.01 Y 18 12750912 Y152C A G missense Het probably benign 0.045 0.090 phenotype 11/06/2018
4 538829 UTSW Cactin 0.576 R6907 G1 225.01 Y 10 81323444 G A critical splice donor site 1 bp Het probably null 11/06/2018
5 538817 UTSW Cadps2 0.000 R6907 G1 225.01 Y 6 23599506 D238G T C missense Het probably damaging 1.000 0.648 phenotype 11/06/2018
6 538839 UTSW Card10 0.070 R6907 G1 225.01 Y 15 78787471 T598A T C missense Het possibly damaging 0.822 0.060 phenotype 11/06/2018
7 538821 UTSW Ctr9 1.000 R6907 G1 225.01 Y 7 111030242 P25L C T missense Het probably damaging 1.000 0.920 phenotype 11/06/2018
8 538834 UTSW Entpd5 0.000 R6907 G1 225.01 Y 12 84377353 T409A T C missense Het probably benign 0.227 phenotype 11/06/2018
9 538809 UTSW Exd1 0.000 R6907 G1 225.01 Y 2 119533476 V137A A G missense Het probably damaging 0.999 phenotype 11/06/2018
10 538819 UTSW Fcgbp 0.000 R6907 G1 225.01 Y 7 28085018 G168R G A missense Het probably damaging 1.000 11/06/2018
11 538838 UTSW Ift88 1.000 R6907 G1 225.01 Y 14 57445610 N248S A G missense Het probably benign 0.232 phenotype 11/06/2018
12 538816 UTSW Kntc1 0.942 R6907 G1 225.01 Y 5 123801825 Y1561N T A missense Het probably damaging 1.000 0.605 phenotype 11/06/2018
13 538836 UTSW Mef2c 1.000 R6907 G1 225.01 Y 13 83654611 D227G A G missense Het probably benign 0.316 0.116 phenotype 11/06/2018
14 538831 UTSW Myh2 0.185 R6907 G1 225.01 Y 11 67193741 T1702M C T missense Het probably damaging 0.997 phenotype 11/06/2018
15 538828 UTSW Myo1e 0.000 R6907 G1 225.01 Y 9 70327155 N263K T A missense Het probably benign 0.000 phenotype 11/06/2018
16 538833 UTSW Nfe2l1 1.000 R6907 G1 225.01 Y 11 96819810 L373P A G missense Het probably damaging 0.997 phenotype 11/06/2018
17 538823 UTSW Nob1 0.962 R6907 G1 225.01 Y 8 107416228 V274M C T missense Het possibly damaging 0.896 phenotype 11/06/2018
18 538807 UTSW Ntng2 0.376 R6907 G1 225.01 Y 2 29228206 C77R A G missense Het probably damaging 1.000 0.942 phenotype 11/06/2018
19 538837 UTSW Nynrin 0.000 R6907 G1 225.01 Y 14 55863878 S335A T G missense Het probably benign 0.202 0.090 11/06/2018
20 538840 UTSW Olfr288 0.070 R6907 G1 225.01 Y 15 98187768 N10D T C missense Het probably damaging 0.998 0.357 phenotype 11/06/2018
21 538820 UTSW Olfr476 0.097 R6907 G1 225.01 Y 7 107968252 L285P T C missense Het probably damaging 1.000 phenotype 11/06/2018
22 538814 UTSW Pcdh7 0.187 R6907 G1 225.01 Y 5 57719129 W9R T A missense Het possibly damaging 0.531 phenotype 11/06/2018
23 538843 UTSW Pcdha1 0.000 R6907 G1 225.01 Y 18 36931071 T263A A G missense Het probably benign 0.008 phenotype 11/06/2018
24 538813 UTSW Per3 0.179 R6907 G1 225.01 Y 4 151043558 C T critical splice donor site 1 bp Het probably null phenotype 11/06/2018
25 538825 UTSW Pgbd5 0.000 R6907 G1 225.01 Y 8 124380282 F265L A G missense Het probably damaging 0.969 phenotype 11/06/2018
26 538818 UTSW Ppm1k 0.054 R6907 G1 225.01 Y 6 57510770 E356A T G missense Het probably benign 0.008 0.062 phenotype 11/06/2018
27 538811 UTSW Ptgfr 0.091 R6907 G1 225.01 Y 3 151835301 T190K G T missense Het possibly damaging 0.955 0.222 phenotype 11/06/2018
28 538830 UTSW Sec24a 0.000 R6907 G1 225.01 Y 11 51712276 Y782H A G missense Het probably damaging 1.000 phenotype 11/06/2018
29 538815 UTSW Setd1b 1.000 R6907 G1 225.01 Y 5 123163232 T C unclassified Het probably benign 0.128 phenotype 11/06/2018
30 538812 UTSW Sfpq 1.000 R6907 G1 217.47 N 4 127021626 GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC small deletion Het probably benign phenotype 11/06/2018
31 538806 UTSW Slc19a2 0.161 R6907 G1 225.01 Y 1 164262754 T253I C T missense Het possibly damaging 0.788 0.061 phenotype 11/06/2018
32 538844 UTSW Tcf4 1.000 R6907 G1 225.01 Y 18 69652413 T207M C T missense Het probably damaging 1.000 0.647 phenotype 11/06/2018
33 538841 UTSW Thada 0.000 R6907 G1 225.01 Y 17 84393469 N1203S T C missense Het probably damaging 1.000 0.946 phenotype 11/06/2018
34 538827 UTSW Tln2 0.226 R6907 G1 225.01 Y 9 67397635 S5T A T missense Het probably damaging 0.977 phenotype 11/06/2018
35 538832 UTSW Traf4 0.927 R6907 G1 225.01 Y 11 78160442 R296Q C T missense Het probably benign 0.028 0.093 phenotype 11/06/2018
36 538810 UTSW Ttbk2 1.000 R6907 G1 225.01 Y 2 120825270 S38P A G missense Het probably benign 0.002 phenotype 11/06/2018
37 538835 UTSW Vrk1 0.862 R6907 G1 225.01 Y 12 106075032 Q395H G T missense Het possibly damaging 0.896 0.103 phenotype 11/06/2018
38 538822 UTSW Vwa3a 0.000 R6907 G1 225.01 Y 7 120792581 G T unclassified Het probably benign 11/06/2018
39 538808 UTSW Wdsub1 0.117 R6907 G1 225.01 Y 2 59861684 V335I C T missense Het possibly damaging 0.593 0.191 11/06/2018
[records 1 to 39 of 39]