Incidental Mutations

62 incidental mutations are currently displayed, and affect 62 genes.
8 are Possibly Damaging.
22 are Probably Damaging.
24 are Probably Benign.
6 are Probably Null.
3 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 62 of 62] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 539345 UTSW 1600015I10Rik 0.108 R6916 G1 225.01 Y 6 48931053 I329N T A missense Het probably benign 0.009 0.090 11/06/2018
2 539369 UTSW 2700049A03Rik 1.000 R6916 G1 225.01 Y 12 71164544 I684K T A missense Het possibly damaging 0.856 phenotype 11/06/2018
3 539344 UTSW Abcg3 0.074 R6916 G1 225.01 Y 5 104974735 R97S T A missense Het probably benign 0.161 phenotype 11/06/2018
4 539373 UTSW Acin1 0.948 R6916 G1 225.01 Y 14 54665416 F160L A T missense Het probably benign 0.271 phenotype 11/06/2018
5 539340 UTSW Asb10 0.000 R6916 G1 225.01 Y 5 24537856 D293G T C missense Het probably damaging 1.000 phenotype 11/06/2018
6 539375 UTSW Atp6v1c1 1.000 R6916 G1 225.01 Y 15 38677581 S117P T C missense Het probably benign 0.004 phenotype 11/06/2018
7 539368 UTSW Bahcc1 0.798 R6916 G1 225.01 Y 11 120273009 V711E T A missense Het probably damaging 1.000 0.230 phenotype 11/06/2018
8 539324 UTSW Baz2b 0.232 R6916 G1 225.01 Y 2 59968776 S335T A T missense Het probably benign 0.000 phenotype 11/06/2018
9 539370 UTSW Bdkrb2 0.109 R6916 G1 225.01 Y 12 105591779 A93V C T missense Het probably damaging 0.962 0.538 phenotype 11/06/2018
10 539372 UTSW Cacna1d 0.784 R6916 G1 225.01 Y 14 30095364 V1247D A T missense Het probably damaging 1.000 phenotype 11/06/2018
11 539327 UTSW Cenpb 0.310 R6916 G1 225.01 Y 2 131179624 F85V A C missense Het probably benign 0.035 0.273 phenotype 11/06/2018
12 539367 UTSW Cep112 0.499 R6916 G1 225.01 Y 11 108859376 Q142K C A missense Het probably damaging 0.999 0.104 phenotype 11/06/2018
13 554315 UTSW Ciita 0.122 R6916 G1 150.01 Y 16 10509207 T A intron Het probably null 0.976 phenotype 05/20/2019
14 539337 UTSW Cnr1 0.300 R6916 G1 225.01 Y 4 33943897 D95G A G missense Het probably benign 0.000 0.090 phenotype 11/06/2018
15 539326 UTSW Ctnnd1 1.000 R6916 G1 225.01 Y 2 84609646 D767E A T missense Het probably benign 0.019 phenotype 11/06/2018
16 539335 UTSW Ddx20 1.000 R6916 G1 225.01 Y 3 105680613 N384D T C missense Het probably damaging 1.000 0.932 phenotype 11/06/2018
17 539347 UTSW Dnaaf3 0.463 R6916 G1 225.01 Y 7 4527533 D191V T A missense Het probably damaging 1.000 phenotype 11/06/2018
18 539332 UTSW Efna1 0.000 R6916 G1 225.01 Y 3 89276388 N44D T C missense Het possibly damaging 0.648 0.278 phenotype 11/06/2018
19 539339 UTSW Errfi1 0.436 R6916 G1 225.01 Y 4 150867473 K453* A T nonsense Het probably null 0.976 phenotype 11/06/2018
20 539352 UTSW Fam149a 0.000 R6916 G1 225.01 Y 8 45350406 K349N C A missense Het probably damaging 0.997 11/06/2018
21 539366 UTSW Fbxl20 0.349 R6916 G1 225.01 Y 11 98113253 I70L T A missense Het possibly damaging 0.782 phenotype 11/06/2018
22 539371 UTSW Flnb 1.000 R6916 G1 225.01 Y 14 7907171 T1248I C T missense Het probably damaging 0.994 phenotype 11/06/2018
23 539329 UTSW Frem2 1.000 R6916 G1 225.01 Y 3 53547688 R2156G T C missense Het probably damaging 1.000 phenotype 11/06/2018
24 539349 UTSW Ftl1 0.000 R6916 G1 225.01 N 7 45459540 Y31C T C missense Het probably damaging 0.980 phenotype 11/06/2018
25 539341 UTSW Gm5862 0.181 R6916 G1 225.01 Y 5 26019348 H208N G T missense Het probably benign 0.000 11/06/2018
26 539323 UTSW Hc 0.635 R6916 G1 225.01 Y 2 35010032 Y1096* A T nonsense Het probably null phenotype 11/06/2018
27 539380 UTSW Hps1 0.347 R6916 G1 120.47 N 19 42766725 ATCCTCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC Het phenotype 11/06/2018
28 539333 UTSW Ints3 0.968 R6916 G1 225.01 Y 3 90406334 D329G T C missense Het probably damaging 1.000 0.307 phenotype 11/06/2018
29 539363 UTSW Irak3 0.532 R6916 G1 204.01 Y 10 120201365 L32Q A T missense Het probably damaging 0.998 phenotype 11/06/2018
30 539361 UTSW Kif1bp 1.000 R6916 G1 225.01 Y 10 62566064 T20A T C missense Het probably benign 0.052 0.058 phenotype 11/06/2018
31 539346 UTSW Klrb1f 0.052 R6916 G1 225.01 Y 6 129053811 D95V A T missense Het probably benign 0.000 0.090 11/06/2018
32 539376 UTSW Krt79 0.000 R6916 G1 225.01 Y 15 101936170 D260N C T missense Het probably benign 0.015 0.294 phenotype 11/06/2018
33 539359 UTSW Lrp11 0.077 R6916 G1 225.01 N 10 7608714 C A intron 75 bp Het probably null 11/06/2018
34 539362 UTSW Lrrc10 0.000 R6916 G1 225.01 Y 10 117045549 R43S C A missense Het possibly damaging 0.795 0.149 phenotype 11/06/2018
35 539351 UTSW Muc5b 0.172 R6916 G1 225.01 Y 7 141864717 Y3800F A T missense Het possibly damaging 0.711 phenotype 11/06/2018
36 539348 UTSW Myh14 0.000 R6916 G1 225.01 Y 7 44629313 K1003E T C missense Het probably damaging 0.960 0.070 phenotype 11/06/2018
37 539357 UTSW Nbeal2 0.275 R6916 G1 225.01 Y 9 110626108 I2567T A G missense Het probably damaging 1.000 phenotype 11/06/2018
38 539353 UTSW Necab2 0.000 R6916 G1 225.01 Y 8 119467616 R277L G T missense Het probably damaging 0.977 phenotype 11/06/2018
39 539350 UTSW Nell1 1.000 R6916 G1 225.01 Y 7 50701179 Y525H T C missense Het probably benign 0.002 0.088 phenotype 11/06/2018
40 539374 UTSW Olfm4 0.072 R6916 G1 225.01 Y 14 80014198 M186K T A missense Het probably damaging 0.968 0.249 phenotype 11/06/2018
41 539365 UTSW Olfr389 0.055 R6916 G1 225.01 Y 11 73777069 Q86L T A missense Het probably benign 0.001 0.084 phenotype 11/06/2018
42 539378 UTSW Olfr753-ps1 0.124 R6916 G1 225.01 Y 17 37169973 K225R T C missense Het probably benign 0.000 11/06/2018
43 539354 UTSW Olfr934 0.069 R6916 G1 225.01 Y 9 38982904 I47V T C missense Het probably benign 0.138 phenotype 11/06/2018
44 539379 UTSW Pcdhb11 0.098 R6916 G1 225.01 Y 18 37422381 S255C A T missense Het possibly damaging 0.518 0.145 11/06/2018
45 539328 UTSW Rrbp1 0.226 R6916 G1 225.01 Y 2 143974598 C704S A T missense Het probably benign 0.032 0.090 11/06/2018
46 539330 UTSW Rsrc1 0.118 R6916 G1 225.01 Y 3 66994649 P44L C T missense Het unknown 0.087 phenotype 11/06/2018
47 539322 UTSW Sh2d3c 1.000 R6916 G1 225.01 Y 2 32752653 R552* C T nonsense Het probably null phenotype 11/06/2018
48 539331 UTSW Sh3d19 0.000 R6916 G1 225.01 Y 3 86084911 E82G A G missense Het probably benign 0.025 0.157 phenotype 11/06/2018
49 539377 UTSW Son 0.957 R6916 G1 225.01 Y 16 91654785 L140Q T A missense Het probably damaging 0.972 0.647 phenotype 11/06/2018
50 554316 UTSW Svil 0.294 R6916 G1 225.01 Y 18 5114682 G A utr 3 prime Het probably benign phenotype 05/20/2019
51 539358 UTSW Syne1 1.000 R6916 G1 225.01 Y 10 5227912 K4854R T C missense Het probably benign 0.001 phenotype 11/06/2018
52 539355 UTSW Tmem202 0.060 R6916 G1 225.01 Y 9 59525474 C A start gained Het probably benign 0.090 11/06/2018
53 539336 UTSW Tmem56 0.080 R6916 G1 225.01 Y 3 121207156 D276G T C missense Het possibly damaging 0.936 0.126 11/06/2018
54 539321 UTSW Trak2 0.000 R6916 G1 225.01 Y 1 58910025 T539A T C missense Het probably benign 0.056 0.090 11/06/2018
55 539360 UTSW Trdn 0.071 R6916 G1 225.01 Y 10 33157018 S80P T C missense Het probably damaging 1.000 phenotype 11/06/2018
56 539343 UTSW Ugt2b37 0.077 R6916 G1 225.01 Y 5 87254600 R57S T A missense Het probably benign 0.067 11/06/2018
57 539364 UTSW Usp34 0.692 R6916 G1 225.01 Y 11 23458023 R2616Q G A missense Het probably damaging 0.975 0.113 11/06/2018
58 539338 UTSW Usp48 0.962 R6916 G1 225.01 Y 4 137638233 Y113H T C missense Het probably damaging 1.000 0.533 phenotype 11/06/2018
59 539334 UTSW Vtcn1 0.120 R6916 G1 225.01 Y 3 100888163 G T critical splice acceptor site Het probably null 0.948 phenotype 11/06/2018
60 539342 UTSW Wdr19 1.000 R6916 G1 225.01 Y 5 65225334 R467Q G A missense Het possibly damaging 0.638 phenotype 11/06/2018
61 539356 UTSW Wdr72 0.151 R6916 G1 225.01 Y 9 74155039 Y489C A G missense Het probably benign 0.000 0.090 phenotype 11/06/2018
62 539325 UTSW Wipf1 0.187 R6916 G1 167.01 Y 2 73437404 G217W C A missense Het probably damaging 1.000 phenotype 11/06/2018
[records 1 to 62 of 62]