Incidental Mutations

78 incidental mutations are currently displayed, and affect 78 genes.
10 are Possibly Damaging.
27 are Probably Damaging.
30 are Probably Benign.
9 are Probably Null.
4 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 78 of 78] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 541534 UTSW 2210016F16Rik 0.197 R6957 G1 225.01 N 13 58381961 C279F C A missense Het probably damaging 1.000 11/28/2018
2 541485 UTSW 2310009B15Rik 0.082 R6957 G1 225.01 N 1 138852119 S132P A G missense Het probably damaging 1.000 11/28/2018
3 541523 UTSW 4932415D10Rik 0.074 R6957 G1 225.01 N 10 82293786 I1130K A T missense Het probably benign 0.026 11/28/2018
4 541531 UTSW Abcb5 0.175 R6957 G1 225.01 N 12 118907535 F710L A G missense Het probably damaging 0.999 phenotype 11/28/2018
5 541511 UTSW Acsm4 0.081 R6957 G1 225.01 N 7 119711399 V503G T G missense Het probably damaging 0.999 11/28/2018
6 541513 UTSW Adam26a 0.000 R6957 G1 225.01 N 8 43568903 M517L T A missense Het probably benign 0.003 phenotype 11/28/2018
7 541486 UTSW Adcy10 0.291 R6957 G1 225.01 N 1 165564285 L1345I C A missense Het probably damaging 1.000 phenotype 11/28/2018
8 541535 UTSW Adgrv1 0.000 R6957 G1 225.01 N 13 81567490 I860V T C missense Het probably benign 0.002 phenotype 11/28/2018
9 541550 UTSW Alcam 0.295 R6957 G1 225.01 N 16 52276894 D333G T C missense Het probably damaging 1.000 phenotype 11/28/2018
10 541521 UTSW Amt 1.000 R6957 G1 225.01 N 9 108299833 F213L C A missense Het possibly damaging 0.511 phenotype 11/28/2018
11 541522 UTSW Ascc3 0.958 R6957 G1 225.01 N 10 50728182 T1333A A G missense Het probably damaging 1.000 phenotype 11/28/2018
12 541556 UTSW Asxl3 0.444 R6957 G1 225.01 N 18 22522091 L1053I C A missense Het probably damaging 1.000 11/28/2018
13 541545 UTSW Atxn10 1.000 R6957 G1 225.01 N 15 85336498 S12P T C missense Het probably damaging 0.997 phenotype 11/28/2018
14 541548 UTSW AU021092 0.000 R6957 G1 225.01 N 16 5212153 I333V T C missense Het probably benign 0.034 phenotype 11/28/2018
15 541554 UTSW Birc6 1.000 R6957 G1 225.01 N 17 74579491 I577V A G missense Het probably benign 0.000 phenotype 11/28/2018
16 541552 UTSW Cadm2 0.595 R6957 G1 225.01 N 16 66812838 F132I A T missense Het probably benign 0.019 phenotype 11/28/2018
17 541514 UTSW Casp3 1.000 R6957 G1 225.01 N 8 46634273 V85D T A missense Het probably damaging 1.000 phenotype 11/28/2018
18 541526 UTSW Ccdc85a 0.311 R6957 G1 225.01 N 11 28392944 A T intron Het probably benign 11/28/2018
19 541509 UTSW Cd22 0.000 R6957 G1 225.01 N 7 30867574 R760G T C missense Het possibly damaging 0.880 phenotype 11/28/2018
20 541499 UTSW Cela3a 0.073 R6957 G1 225.01 N 4 137408130 W41R A T missense Het probably damaging 1.000 phenotype 11/28/2018
21 541519 UTSW Cep164 1.000 R6957 G1 225.01 N 9 45772280 A G critical splice donor site 2 bp Het probably null phenotype 11/28/2018
22 541484 UTSW Cntnap5b 0.130 R6957 G1 225.01 N 1 100274472 E348G A G missense Het probably benign 0.080 11/28/2018
23 541495 UTSW Ddx20 1.000 R6957 G1 225.01 N 3 105684310 K181N C A missense Het probably benign 0.303 phenotype 11/28/2018
24 541487 UTSW Dnah14 0.114 R6957 G1 225.01 N 1 181785175 A3846P G C missense Het possibly damaging 0.918 phenotype 11/28/2018
25 541528 UTSW Ern1 1.000 R6957 G1 225.01 N 11 106403539 I813S A C missense Het probably damaging 0.999 phenotype 11/28/2018
26 541529 UTSW Fam181a 0.119 R6957 G1 225.01 N 12 103316514 G226D G A missense Het probably damaging 0.969 11/28/2018
27 541546 UTSW Fam186a 0.085 R6957 G1 225.01 N 15 99946476 D629V T A missense Het unknown 11/28/2018
28 541542 UTSW Fam84b 0.076 R6957 G1 170.01 N 15 60823085 T271A T C missense Het probably benign 0.000 11/28/2018
29 541508 UTSW Gipr 0.075 R6957 G1 225.01 N 7 19164604 T26S T A missense Het probably benign 0.015 phenotype 11/28/2018
30 541536 UTSW Gm3159 0.069 R6957 G1 185.01 N 14 4398530 R74G A G missense Het possibly damaging 0.944 11/28/2018
31 541483 UTSW Gm8251 0.120 R6957 G1 225.01 N 1 44057207 C1577Y C T missense Het probably benign 0.003 11/28/2018
32 541555 UTSW Greb1l 1.000 R6957 G1 225.01 N 18 10558786 V1814I G A missense Het probably benign 0.227 11/28/2018
33 541488 UTSW Hacd1 0.238 R6957 G1 225.01 N 2 14044853 V98E A T missense Het probably damaging 1.000 phenotype 11/28/2018
34 541533 UTSW Iars 1.000 R6957 G1 225.01 N 13 49722161 F775V T G missense Het probably damaging 0.998 phenotype 11/28/2018
35 541505 UTSW Il12rb2 0.000 R6957 G1 225.01 N 6 67292652 L726F G A missense Het possibly damaging 0.600 phenotype 11/28/2018
36 541538 UTSW Itih4 0.000 R6957 G1 225.01 N 14 30892603 V474A T C missense Het probably damaging 1.000 phenotype 11/28/2018
37 541518 UTSW Kmt2a 1.000 R6957 G1 225.01 N 9 44820022 A C unclassified Het probably benign phenotype 11/28/2018
38 541540 UTSW Ktn1 0.000 R6957 G1 225.01 N 14 47667353 L196* T A nonsense Het probably null phenotype 11/28/2018
39 541559 UTSW Lipo4 0.081 R6957 G1 225.01 N 19 33499367 V327A A G missense Het probably benign 0.298 11/28/2018
40 541539 UTSW Lrit1 0.072 R6957 G1 225.01 N 14 37060095 V242L G C missense Het probably damaging 0.992 0.186 phenotype 11/28/2018
41 541492 UTSW Lrp4 0.646 R6957 G1 225.01 N 2 91487042 T837K C A missense Het probably damaging 0.994 phenotype 11/28/2018
42 541504 UTSW Mad1l1 1.000 R6957 G1 225.01 N 5 140065817 F664L G T missense Het probably damaging 0.989 phenotype 11/28/2018
43 541498 UTSW Mecr 1.000 R6957 G1 225.01 N 4 131861861 T247A A G missense Het probably benign 0.001 11/28/2018
44 541503 UTSW Msi1 0.433 R6957 G1 225.01 N 5 115445424 A228T G A missense Het probably benign 0.037 phenotype 11/28/2018
45 541497 UTSW Mup5 0.148 R6957 G1 225.01 N 4 61833036 N125I T A missense Het probably damaging 1.000 11/28/2018
46 541493 UTSW Mybl2 1.000 R6957 G1 190.01 N 2 163072808 S282F C T missense Het possibly damaging 0.858 phenotype 11/28/2018
47 541512 UTSW Myom2 0.128 R6957 G1 225.01 N 8 15117741 A1109T G A missense Het probably null 0.420 0.115 phenotype 11/28/2018
48 541541 UTSW Nalcn 1.000 R6957 G1 225.01 N 14 123507554 D354G T C missense Het probably damaging 0.958 phenotype 11/28/2018
49 541547 UTSW Nckap1l 0.892 R6957 G1 225.01 N 15 103491511 V1040A T C missense Het possibly damaging 0.910 phenotype 11/28/2018
50 541506 UTSW Nlrp12 0.126 R6957 G1 225.01 N 7 3222486 D1051V T A missense Het probably damaging 0.995 phenotype 11/28/2018
51 541516 UTSW Nudt7 0.073 R6957 G1 225.01 N 8 114133645 K16R A G missense Het probably benign 0.026 phenotype 11/28/2018
52 541491 UTSW Olfr1270 0.101 R6957 G1 225.01 N 2 90149150 Y285* G T nonsense Het probably null phenotype 11/28/2018
53 541517 UTSW Olfr947-ps1 R6957 G1 225.01 N 9 39289281 V203A A G missense Het unknown 11/28/2018
54 541501 UTSW Paqr3 0.109 R6957 G1 225.01 N 5 97108251 I88K A T missense Het possibly damaging 0.478 phenotype 11/28/2018
55 541549 UTSW Parp9 0.179 R6957 G1 225.01 N 16 35948346 M299V A G missense Het probably benign 0.004 11/28/2018
56 541494 UTSW Pde4dip 1.000 R6957 G1 225.01 N 3 97824333 A T splice site Het probably null phenotype 11/28/2018
57 541525 UTSW Pex13 1.000 R6957 G1 225.01 N 11 23655628 M201L T G missense Het probably benign 0.000 phenotype 11/28/2018
58 541527 UTSW Pfas 1.000 R6957 G1 225.01 N 11 68993883 V498L C A missense Het probably benign 0.138 phenotype 11/28/2018
59 541560 UTSW Phka2 0.155 R6957 G1 222 N X 160533048 V230I G A missense Het probably damaging 0.992 0.217 phenotype 11/28/2018
60 541543 UTSW Plec 0.792 R6957 G1 225.01 N 15 76186214 D932V T A missense Het probably damaging 1.000 phenotype 11/28/2018
61 541489 UTSW Qsox2 0.078 R6957 G1 225.01 N 2 26217642 A445T C T missense Het probably benign 0.401 phenotype 11/28/2018
62 541490 UTSW Rapgef1 1.000 R6957 G1 225.01 N 2 29733698 Q820K C A missense Het possibly damaging 0.615 phenotype 11/28/2018
63 541496 UTSW Samd13 0.358 R6957 G1 225.01 N 3 146662669 A G critical splice donor site 2 bp Het probably null 11/28/2018
64 541544 UTSW Samm50 0.941 R6957 G1 225.01 N 15 84198649 D104Y G T missense Het probably damaging 1.000 phenotype 11/28/2018
65 541507 UTSW Sbk3 0.103 R6957 G1 225.01 N 7 4967523 F282L A T missense Het probably benign 0.000 11/28/2018
66 541537 UTSW Sfmbt1 0.684 R6957 G1 225.01 N 14 30787589 H342Y C T missense Het probably benign 0.002 phenotype 11/28/2018
67 541515 UTSW Sgo2b 0.100 R6957 G1 120.47 N 8 63931455 CCATCATCATCATCATCATCAT CCATCATCATCATCATCAT small deletion Het probably benign 11/28/2018
68 541557 UTSW Slc12a2 0.000 R6957 G1 225.01 N 18 57910272 L596* T A nonsense Het probably null phenotype 11/28/2018
69 541558 UTSW St8sia3 0.159 R6957 G1 225.01 N 18 64271782 S377P T C missense Het probably benign 0.252 phenotype 11/28/2018
70 541532 UTSW Stmnd1 0.064 R6957 G1 225.01 N 13 46273899 S28A T G missense Het probably benign 0.090 11/28/2018
71 541530 UTSW Syne3 0.000 R6957 G1 225.01 N 12 104954302 L458Q A T missense Het probably damaging 0.998 11/28/2018
72 541510 UTSW Synm 0.000 R6957 G1 225.01 N 7 67736100 V163I C T missense Het probably benign 0.278 phenotype 11/28/2018
73 541551 UTSW Tbc1d23 0.600 R6957 G1 225.01 N 16 57208323 C161R A G missense Het probably damaging 1.000 phenotype 11/28/2018
74 541500 UTSW Tnfrsf4 0.061 R6957 G1 225.01 N 4 156016168 V215I G A missense Het probably benign 0.001 phenotype 11/28/2018
75 541553 UTSW Vars2 1.000 R6957 G1 225.01 N 17 35667075 K67Q T G missense Het probably benign 0.391 phenotype 11/28/2018
76 541502 UTSW Vmn2r13 0.071 R6957 G1 225.01 N 5 109156887 Y559* A T nonsense Het probably null 11/28/2018
77 541524 UTSW Wdpcp 0.677 R6957 G1 225.01 N 11 21721154 I465T T C missense Het possibly damaging 0.941 phenotype 11/28/2018
78 541520 UTSW Zwilch 1.000 R6957 G1 225.01 N 9 64162562 A C critical splice donor site 2 bp Het probably null 11/28/2018
[records 1 to 78 of 78]