Incidental Mutations

66 incidental mutations are currently displayed, and affect 65 genes.
8 are Possibly Damaging.
26 are Probably Damaging.
24 are Probably Benign.
7 are Probably Null.
5 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 66 of 66] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 543839 UTSW 2310022A10Rik 0.216 R6991 G1 225.01 N 7 27580446 V278D T A missense Het probably damaging 1.000 05/13/2019
2 543870 UTSW 2410089E03Rik 1.000 R6991 G1 225.01 N 15 8252206 E2843G A G missense Het unknown phenotype 05/13/2019
3 543881 UTSW 9930021J03Rik 0.109 R6991 G1 225.01 N 19 29719108 L995S A G missense Het possibly damaging 0.861 05/13/2019
4 543853 UTSW Akap12 0.095 R6991 G1 225.01 N 10 4357122 E1311* G T nonsense Het probably null phenotype 05/13/2019
5 543850 UTSW Ankdd1a 0.148 R6991 G1 225.01 N 9 65508675 D186V T A missense Het probably benign 0.216 05/13/2019
6 543877 UTSW Birc6 1.000 R6991 G1 225.01 N 17 74562095 E346G A G missense Het probably damaging 1.000 phenotype 05/13/2019
7 543858 UTSW Ccr7 0.206 R6991 G1 225.01 N 11 99145304 V264G A C missense Het probably damaging 1.000 phenotype 05/13/2019
8 543851 UTSW Col7a1 1.000 R6991 G1 225.01 N 9 108983919 T C critical splice donor site 2 bp Het probably null phenotype 05/13/2019
9 543820 UTSW Coq8a 0.760 R6991 G1 225.01 N 1 180179068 T132A T C missense Het probably benign 0.002 phenotype 05/13/2019
10 543838 UTSW Cyp2b10 0.077 R6991 G1 225.01 N 7 25917355 S407N G A missense Het probably benign 0.052 phenotype 05/13/2019
11 543832 UTSW Ddi2 0.926 R6991 G1 225.01 N 4 141685250 V117A A G missense Het probably benign 0.223 05/13/2019
12 543859 UTSW Ddx42 1.000 R6991 G1 225.01 N 11 106239144 V421I G A missense Het probably damaging 0.998 phenotype 05/13/2019
13 543862 UTSW Dip2c 0.538 R6991 G1 225.01 N 13 9551860 L285* T A nonsense Het probably null phenotype 05/13/2019
14 543863 UTSW Dip2c 0.538 R6991 G1 225.01 N 13 9634832 S1232F C T missense Het probably damaging 1.000 phenotype 05/13/2019
15 543817 UTSW Dner 0.000 R6991 G1 225.01 N 1 84476402 R402* T A nonsense Het probably null phenotype 05/13/2019
16 543879 UTSW Dpysl3 0.458 R6991 G1 225.01 N 18 43353891 I317N A T missense Het probably damaging 1.000 phenotype 05/13/2019
17 543819 UTSW Dusp23 0.086 R6991 G1 193.01 N 1 172631657 Y146F T A missense Het probably benign 0.001 05/13/2019
18 543826 UTSW Eef1a2 0.000 R6991 G1 225.01 N 2 181148628 V412L C A missense Het possibly damaging 0.705 phenotype 05/13/2019
19 543829 UTSW Epha7 0.680 R6991 G1 225.01 N 4 28821489 T218I C T missense Het probably damaging 1.000 phenotype 05/13/2019
20 543818 UTSW Gigyf2 0.937 R6991 G1 225.01 N 1 87407136 C284S T A missense Het probably damaging 0.998 phenotype 05/13/2019
21 543833 UTSW Gm16427 R6991 G1 220.01 N 5 93484374 N107I T A missense Het probably damaging 0.993 05/13/2019
22 543865 UTSW Golm1 0.065 R6991 G1 217.47 N 13 59649576 ACTTCTTCT ACTTCT small deletion Het probably benign 0.090 phenotype 05/13/2019
23 543827 UTSW Hao2 0.000 R6991 G1 225.01 N 3 98876752 E327V T A missense Het probably damaging 1.000 phenotype 05/13/2019
24 543837 UTSW Hdhd5 0.075 R6991 G1 225.01 N 6 120510169 V409A A G missense Het probably damaging 0.993 05/13/2019
25 543852 UTSW Kif9 0.189 R6991 G1 225.01 N 9 110494622 Y236H T C missense Het probably damaging 1.000 05/13/2019
26 543849 UTSW Kri1 1.000 R6991 G1 225.01 N 9 21287754 T C unclassified Het probably benign phenotype 05/13/2019
27 543845 UTSW Lig4 1.000 R6991 G1 225.01 N 8 9971098 V894E A T missense Het probably damaging 0.989 phenotype 05/13/2019
28 543855 UTSW Lrriq1 0.074 R6991 G1 225.01 N 10 103187458 N982S T C missense Het probably damaging 1.000 05/13/2019
29 543868 UTSW Mapk8 0.689 R6991 G1 225.01 N 14 33410884 I32V T C missense Het possibly damaging 0.822 phenotype 05/13/2019
30 543867 UTSW Mast4 0.449 R6991 G1 225.01 N 13 102804647 V301I C T missense Het probably damaging 1.000 0.152 phenotype 05/13/2019
31 543816 UTSW Mstn 0.321 R6991 G1 225.01 N 1 53061941 I59T T C missense Het probably benign 0.021 phenotype 05/13/2019
32 543854 UTSW Mtrf1l 1.000 R6991 G1 225.01 N 10 5813384 E315G T C missense Het probably damaging 1.000 0.645 phenotype 05/13/2019
33 543875 UTSW Notch4 0.000 R6991 G1 225.01 N 17 34584800 E1515* G T nonsense Het probably null phenotype 05/13/2019
34 543874 UTSW Npw 0.059 R6991 G1 225.01 N 17 24658055 V124G A C missense Het probably benign 0.000 phenotype 05/13/2019
35 543857 UTSW Nxph3 0.105 R6991 G1 225.01 N 11 95511418 S57P A G missense Het probably damaging 0.966 phenotype 05/13/2019
36 543822 UTSW Olfr1000 0.065 R6991 G1 225.01 N 2 85608248 I221V T C missense Het possibly damaging 0.765 phenotype 05/13/2019
37 543823 UTSW Olfr1145 0.057 R6991 G1 225.01 N 2 87810443 D208N G A missense Het possibly damaging 0.763 phenotype 05/13/2019
38 543880 UTSW Olfr1443 0.054 R6991 G1 225.01 N 19 12680748 L213F G T missense Het probably benign 0.144 phenotype 05/13/2019
39 543843 UTSW Olfr493 0.133 R6991 G1 213.01 N 7 108346088 N298Y T A missense Het possibly damaging 0.922 phenotype 05/13/2019
40 543842 UTSW Olfr677 0.108 R6991 G1 225.01 N 7 105056564 I106T T C missense Het probably damaging 0.999 phenotype 05/13/2019
41 543869 UTSW Opn4 0.000 R6991 G1 225.01 N 14 34593907 L390M A T missense Het probably benign 0.381 phenotype 05/13/2019
42 543848 UTSW Pkd1l3 0.000 R6991 G1 214.46 N 8 109624195 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA small deletion Het probably benign phenotype 05/13/2019
43 543831 UTSW Pla2g2e 0.000 R6991 G1 206.01 N 4 138880675 C62Y G A missense Het probably damaging 1.000 phenotype 05/13/2019
44 543825 UTSW Plcb4 0.000 R6991 G1 225.01 N 2 135910194 V107M G A missense Het probably damaging 1.000 phenotype 05/13/2019
45 543856 UTSW Prorsd1 R6991 G1 225.01 N 11 29514486 A C unclassified Het probably benign 05/13/2019
46 543860 UTSW Prox2 0.000 R6991 G1 225.01 N 12 85087391 L587P A G missense Het probably benign 0.003 phenotype 05/13/2019
47 543876 UTSW Prr22 0.053 R6991 G1 225.01 N 17 56771345 D166G A G missense Het possibly damaging 0.922 05/13/2019
48 543835 UTSW Ptprz1 0.641 R6991 G1 225.01 N 6 23002687 R1592Q G A missense Het probably benign 0.003 phenotype 05/13/2019
49 543871 UTSW Rarg 0.820 R6991 G1 178.01 N 15 102241915 R74P C G missense Het probably damaging 1.000 phenotype 05/13/2019
50 543872 UTSW Rcan1 0.000 R6991 G1 225.01 N 16 92397363 V54A A G missense Het probably benign 0.199 phenotype 05/13/2019
51 543878 UTSW Rmdn2 0.109 R6991 G1 225.01 N 17 79621310 A G start gained Het probably benign 05/13/2019
52 543821 UTSW Sec16a 0.962 R6991 G1 225.01 N 2 26430486 R1361C G A missense Het probably damaging 1.000 phenotype 05/13/2019
53 543861 UTSW Serpina1a 1.000 R6991 G1 225.01 N 12 103853833 T385A T C missense Het probably benign 0.042 phenotype 05/13/2019
54 543828 UTSW Slc44a3 0.000 R6991 G1 225.01 N 3 121532165 Y12C T C missense Het probably benign 0.008 05/13/2019
55 543844 UTSW Smg1 1.000 R6991 G1 225.01 N 7 118167868 C A utr 3 prime Het probably benign phenotype 05/13/2019
56 543847 UTSW Spock3 0.000 R6991 G1 225.01 N 8 63355381 *437W A G makesense Het probably null phenotype 05/13/2019
57 543864 UTSW Sugct 0.147 R6991 G1 225.01 N 13 17554380 Q220H T A missense Het probably benign 0.233 phenotype 05/13/2019
58 543830 UTSW Tesk1 0.445 R6991 G1 225.01 N 4 43447006 T465A A G missense Het probably benign 0.000 phenotype 05/13/2019
59 543846 UTSW Tnks 0.000 R6991 G1 225.01 N 8 34834493 R1274I C A missense Het probably damaging 0.997 phenotype 05/13/2019
60 543824 UTSW Trp53bp1 0.000 R6991 G1 225.01 N 2 121208040 R1439H C T missense Het probably damaging 1.000 phenotype 05/13/2019
61 543836 UTSW Vmn1r16 0.146 R6991 G1 225.01 N 6 57322884 S251* G T nonsense Het probably null 05/13/2019
62 543834 UTSW Vmn2r15 0.087 R6991 G1 225.01 N 5 109293314 Q226L T A missense Het probably damaging 1.000 05/13/2019
63 543841 UTSW Vmn2r67 0.129 R6991 G1 225.01 N 7 85155745 Y53S T G missense Het possibly damaging 0.549 05/13/2019
64 543873 UTSW Vmn2r99 0.109 R6991 G1 225.01 N 17 19378110 N132S A G missense Het probably benign 0.032 05/13/2019
65 543840 UTSW Wdr73 0.201 R6991 G1 225.01 N 7 80891856 T313P T G missense Het probably benign 0.170 phenotype 05/13/2019
66 543866 UTSW Zfp65 0.090 R6991 G1 225.01 N 13 67708521 R213Q C T missense Het probably damaging 0.968 05/13/2019
[records 1 to 66 of 66]