Incidental Mutations

55 incidental mutations are currently displayed, and affect 54 genes.
9 are Possibly Damaging.
22 are Probably Damaging.
21 are Probably Benign.
3 are Probably Null.
2 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 55 of 55] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 544330 UTSW Adam30 0.065 R6998 G1 225.01 N 3 98162710 R620G A G missense Het probably benign 0.025 phenotype 05/13/2019
2 544354 UTSW Adcy1 0.000 R6998 G1 225.01 N 11 7079026 N259H A C missense Het probably damaging 1.000 phenotype 05/13/2019
3 544322 UTSW Ahctf1 1.000 R6998 G1 225.01 N 1 179770915 R2* G A nonsense Het probably null phenotype 05/13/2019
4 544365 UTSW Akr1c21 0.058 R6998 G1 225.01 N 13 4583851 I306M A G missense Het probably benign 0.051 05/13/2019
5 544349 UTSW Alg9 1.000 R6998 G1 225.01 N 9 50789621 S230R T A missense Het possibly damaging 0.953 phenotype 05/13/2019
6 544352 UTSW Armt1 0.176 R6998 G1 225.01 N 10 4453937 C341S T A missense Het probably benign 0.025 05/13/2019
7 544363 UTSW Aspg 0.169 R6998 G1 206.01 N 12 112112194 L29M T A missense Het probably damaging 1.000 05/13/2019
8 544321 UTSW Aspm 0.000 R6998 G1 225.01 N 1 139469472 T934I C T missense Het probably damaging 0.999 phenotype 05/13/2019
9 544342 UTSW C1rl 0.000 R6998 G1 225.01 N 6 124508902 S411P T C missense Het probably damaging 0.999 05/13/2019
10 544359 UTSW Card14 0.076 R6998 G1 225.01 N 11 119322899 E224G A G missense Het probably damaging 1.000 phenotype 05/13/2019
11 544362 UTSW Ccdc88c 0.000 R6998 G1 225.01 N 12 100916852 H1587R T C missense Het probably damaging 0.965 phenotype 05/13/2019
12 544344 UTSW Ccp110 0.866 R6998 G1 225.01 N 7 118732897 T963A A G missense Het possibly damaging 0.907 phenotype 05/13/2019
13 544335 UTSW Cdk11b 1.000 R6998 G1 225.01 N 4 155648343 W546* G A nonsense Het probably null phenotype 05/13/2019
14 544351 UTSW Cyp8b1 0.325 R6998 G1 225.01 N 9 121915993 N91S T C missense Het probably benign 0.000 phenotype 05/13/2019
15 544369 UTSW Dab2 0.919 R6998 G1 225.01 N 15 6424649 M213I G T missense Het possibly damaging 0.485 phenotype 05/13/2019
16 544333 UTSW Decr1 0.572 R6998 G1 225.01 N 4 15930960 V124A A G missense Het probably damaging 1.000 phenotype 05/13/2019
17 544336 UTSW Fbxl13 0.000 R6998 G1 225.01 N 5 21543689 I411F T A missense Het probably damaging 0.999 phenotype 05/13/2019
18 544337 UTSW Fbxl13 0.000 R6998 G1 225.01 N 5 21620613 I164V T C missense Het probably null 0.032 phenotype 05/13/2019
19 544331 UTSW Fndc7 0.000 R6998 G1 225.01 N 3 108876648 A215V G A missense Het probably benign 0.019 0.146 05/13/2019
20 544338 UTSW Garem2 0.260 R6998 G1 225.01 N 5 30114170 M210T T C missense Het possibly damaging 0.879 05/13/2019
21 544361 UTSW Gpatch2l 0.000 R6998 G1 225.01 N 12 86244184 R47H G A missense Het probably damaging 0.999 0.143 05/13/2019
22 544364 UTSW Ighv1-52 0.203 R6998 G1 225.01 N 12 115145492 A115S C A missense Het probably benign 0.434 05/13/2019
23 544340 UTSW Igkv6-13 0.103 R6998 G1 225.01 N 6 70457589 S91P A G missense Het probably damaging 0.997 05/13/2019
24 544332 UTSW Ints8 0.963 R6998 G1 225.01 N 4 11204537 E973V T A missense Het possibly damaging 0.796 phenotype 05/13/2019
25 544357 UTSW Itga3 1.000 R6998 G1 225.01 N 11 95051462 K972R T C missense Het probably benign 0.005 phenotype 05/13/2019
26 544368 UTSW Klhl33 0.132 R6998 G1 225.01 N 14 50893021 F339I A T missense Het probably benign 0.002 05/13/2019
27 544370 UTSW Krt79 0.000 R6998 G1 225.01 N 15 101937872 M214V T C missense Het probably benign 0.000 phenotype 05/13/2019
28 544318 UTSW Lgsn 0.182 R6998 G1 225.01 N 1 31204193 H452L A T missense Het probably benign 0.198 phenotype 05/13/2019
29 544358 UTSW Limd2 0.109 R6998 G1 225.01 N 11 106158690 G124D C T missense Het probably benign 0.112 05/13/2019
30 544334 UTSW Luzp1 0.892 R6998 G1 225.01 N 4 136543444 S993P T C missense Het probably damaging 1.000 phenotype 05/13/2019
31 544347 UTSW Maml2 0.000 R6998 G1 225.01 N 9 13621185 C T unclassified Het probably benign 05/13/2019
32 544356 UTSW Mbtd1 1.000 R6998 G1 225.01 N 11 93924612 H342L A T missense Het probably damaging 1.000 phenotype 05/13/2019
33 544346 UTSW Mfhas1 0.264 R6998 G1 225.01 N 8 35591356 P995Q C A missense Het probably damaging 1.000 phenotype 05/13/2019
34 544345 UTSW Muc5ac 0.000 R6998 G1 225.01 N 7 141818714 F3399S T C missense Het possibly damaging 0.921 phenotype 05/13/2019
35 544327 UTSW Napb 0.166 R6998 G1 225.01 N 2 148700425 Y205C T C missense Het probably damaging 1.000 phenotype 05/13/2019
36 544323 UTSW Odf2 1.000 R6998 G1 171.01 N 2 29912617 A298S G T missense Het probably benign 0.427 phenotype 05/13/2019
37 544325 UTSW Olfr1082 0.406 R6998 G1 225.01 N 2 86594144 M228K A T missense Het probably damaging 0.997 phenotype 05/13/2019
38 544326 UTSW Olfr1193 0.072 R6998 G1 225.01 N 2 88678508 I218F A T missense Het probably benign 0.232 phenotype 05/13/2019
39 544367 UTSW Olfr740 0.086 R6998 G1 225.01 N 14 50453433 Y127F A T missense Het probably benign 0.292 phenotype 05/13/2019
40 544372 UTSW Pcsk5 1.000 R6998 G1 225.01 N 19 17473112 D1124G T C missense Het probably benign 0.200 phenotype 05/13/2019
41 544339 UTSW Peg10 1.000 R6998 G1 193.47 N 6 4756398 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG small deletion Het probably benign phenotype 05/13/2019
42 544320 UTSW Pik3c2b 0.322 R6998 G1 225.01 N 1 133102372 I1457S T G missense Het probably benign 0.226 phenotype 05/13/2019
43 544360 UTSW Pole2 1.000 R6998 G1 225.01 N 12 69213906 T167A T C missense Het possibly damaging 0.821 phenotype 05/13/2019
44 544350 UTSW Rfx7 0.899 R6998 G1 225.01 N 9 72618505 S992R T A missense Het probably damaging 1.000 phenotype 05/13/2019
45 544366 UTSW Ryr2 1.000 R6998 G1 225.01 N 13 11712166 S2436R G T missense Het probably damaging 0.993 phenotype 05/13/2019
46 544319 UTSW Sgo2a 0.000 R6998 G1 225.01 N 1 58016640 D661G A G missense Het probably damaging 0.986 phenotype 05/13/2019
47 544324 UTSW Sh3glb2 0.258 R6998 G1 225.01 N 2 30355321 T49S T A missense Het probably damaging 1.000 05/13/2019
48 544353 UTSW Slc16a10 0.109 R6998 G1 225.01 N 10 40056503 K354R T C missense Het possibly damaging 0.634 phenotype 05/13/2019
49 544341 UTSW Slc6a6 0.000 R6998 G1 225.01 N 6 91752438 T568K C A missense Het probably benign 0.213 phenotype 05/13/2019
50 544355 UTSW Sptbn1 1.000 R6998 G1 225.01 N 11 30100633 T2319A T C missense Het probably damaging 0.966 phenotype 05/13/2019
51 544329 UTSW Tbl1xr1 0.902 R6998 G1 225.01 N 3 22179290 Y15N T A missense Het probably damaging 0.996 phenotype 05/13/2019
52 544348 UTSW Thyn1 0.000 R6998 G1 225.01 N 9 27006442 S160P T C missense Het probably damaging 0.984 phenotype 05/13/2019
53 544371 UTSW Tshz1 1.000 R6998 G1 225.01 N 18 84015841 D147E A T missense Het probably benign 0.001 phenotype 05/13/2019
54 544343 UTSW Vmn2r50 0.118 R6998 G1 225.01 N 7 10037757 R672S T G missense Het probably benign 0.027 05/13/2019
55 544328 UTSW Zfp663 0.062 R6998 G1 225.01 N 2 165354002 I99N A T missense Het possibly damaging 0.740 05/13/2019
[records 1 to 55 of 55]