Incidental Mutations

77 incidental mutations are currently displayed, and affect 77 genes.
11 are Possibly Damaging.
25 are Probably Damaging.
29 are Probably Benign.
9 are Probably Null.
4 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 77 of 77] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 545415 UTSW 2410137M14Rik 0.055 R7017 G1 225.01 Y 17 36978034 A G utr 3 prime Het probably benign 05/13/2019
2 545396 UTSW Acot3 0.076 R7017 G1 156.01 Y 12 84053303 A T start gained Het probably benign 05/13/2019
3 545420 UTSW Add3 0.000 R7017 G1 225.01 Y 19 53233853 V297E T A missense Het possibly damaging 0.938 phenotype 05/13/2019
4 568432 UTSW Arfgap1 0.238 R7017 G1 225.01 Y 2 180976304 C G splice site Het probably null phenotype 07/19/2019
5 545371 UTSW C530008M17Rik 0.000 R7017 G1 199.47 N 5 76856948 GAGGCAGCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GAGACAACGCGAGGCCGAGAGGCAGG small deletion Het probably benign 05/13/2019
6 545407 UTSW Cacna1i 0.000 R7017 G1 225.01 Y 15 80380470 F1500L T C missense Het probably damaging 0.998 phenotype 05/13/2019
7 545348 UTSW Cacna1s 1.000 R7017 G1 225.01 Y 1 136095858 I945T T C missense Het probably damaging 0.994 0.919 phenotype 05/13/2019
8 545365 UTSW Ccdc180 0.000 R7017 G1 225.01 Y 4 45940934 N1334K T A missense Het possibly damaging 0.842 phenotype 05/13/2019
9 545358 UTSW Cd5l 0.000 R7017 G1 225.01 Y 3 87366061 Y112* C A nonsense Het probably null phenotype 05/13/2019
10 545408 UTSW Cyp2d40 0.088 R7017 G1 225.01 Y 15 82760033 F297Y A T missense Het unknown 05/13/2019
11 545401 UTSW Ddx4 0.687 R7017 G1 225.01 Y 13 112601488 V546I C T missense Het probably damaging 0.997 phenotype 05/13/2019
12 545410 UTSW Dgkg 0.104 R7017 G1 225.01 Y 16 22572713 M332V T C missense Het probably benign 0.308 phenotype 05/13/2019
13 545403 UTSW Dnah12 0.179 R7017 G1 225.01 Y 14 26735680 I867T T C missense Het probably benign 0.000 05/13/2019
14 545393 UTSW Dnah2 0.000 R7017 G1 225.01 Y 11 69491547 K1246* T A nonsense Het probably null phenotype 05/13/2019
15 545386 UTSW Drd2 0.378 R7017 G1 225.01 Y 9 49400829 V161I G A missense Het probably benign 0.325 phenotype 05/13/2019
16 545399 UTSW Dsp 1.000 R7017 G1 225.01 Y 13 38186707 D862G A G missense Het probably benign 0.016 phenotype 05/13/2019
17 545372 UTSW Ephx4 0.172 R7017 G1 225.01 Y 5 107406114 F10S T C missense Het probably damaging 0.980 05/13/2019
18 545354 UTSW Fabp9 0.126 R7017 G1 225.01 Y 3 10194696 A76S C A missense Het possibly damaging 0.952 phenotype 05/13/2019
19 545388 UTSW Fam198a 0.047 R7017 G1 225.01 Y 9 121965986 T C critical splice donor site 2 bp Het probably null 05/13/2019
20 545368 UTSW Fam46b 0.175 R7017 G1 225.01 Y 4 133486234 S139P T C missense Het possibly damaging 0.953 05/13/2019
21 545356 UTSW Fat4 1.000 R7017 G1 225.01 Y 3 38891543 M1528I G A missense Het probably benign 0.000 phenotype 05/13/2019
22 545384 UTSW Fbxl12 0.000 R7017 G1 225.01 Y 9 20618320 S84P A G missense Het unknown phenotype 05/13/2019
23 545412 UTSW Fbxo40 0.116 R7017 G1 225.01 Y 16 36970370 D126G T C missense Het probably damaging 1.000 phenotype 05/13/2019
24 545413 UTSW Fpr1 0.000 R7017 G1 225.01 Y 17 17877392 V112I C T missense Het probably benign 0.002 phenotype 05/13/2019
25 545357 UTSW Frem2 1.000 R7017 G1 225.01 Y 3 53519602 N2975S T C missense Het probably benign 0.018 phenotype 05/13/2019
26 545404 UTSW Gm7945 R7017 G1 146.01 N 14 41383653 Y156C T C missense Het 05/13/2019
27 545383 UTSW Gnpat 0.406 R7017 G1 225.01 Y 8 124863275 V13A T C missense Het probably benign 0.326 phenotype 05/13/2019
28 545398 UTSW Gpx5 0.000 R7017 G1 225.01 Y 13 21291391 P55L G A missense Het probably damaging 0.997 phenotype 05/13/2019
29 545395 UTSW Hbp1 0.880 R7017 G1 225.01 Y 12 31943853 S59P A G missense Het probably damaging 0.996 phenotype 05/13/2019
30 545397 UTSW Ighv1-36 0.135 R7017 G1 225.01 Y 12 114879913 D109V T A missense Het probably damaging 1.000 05/13/2019
31 545387 UTSW Iqcf5 0.053 R7017 G1 225.01 Y 9 106515664 I40N T A missense Het possibly damaging 0.897 05/13/2019
32 545402 UTSW Kcnma1 0.829 R7017 G1 225.01 Y 14 23494643 I484L T G missense Het possibly damaging 0.791 phenotype 05/13/2019
33 545389 UTSW Kera 0.000 R7017 G1 225.01 Y 10 97609077 R99S A T missense Het possibly damaging 0.790 phenotype 05/13/2019
34 545350 UTSW Kif3b 1.000 R7017 G1 225.01 Y 2 153329724 S707R T A missense Het possibly damaging 0.873 0.179 phenotype 05/13/2019
35 545377 UTSW Lilra6 0.087 R7017 G1 225.01 Y 7 3908708 T317N G T missense Het possibly damaging 0.928 0.179 05/13/2019
36 545411 UTSW Lrrc15 0.000 R7017 G1 225.01 Y 16 30272962 E520K C T missense Het probably benign 0.001 05/13/2019
37 545355 UTSW Lrrc34 0.063 R7017 G1 225.01 Y 3 30645316 C T critical splice acceptor site Het probably null 05/13/2019
38 545418 UTSW Lvrn 0.471 R7017 G1 225.01 Y 18 46850678 T163A A G missense Het probably benign 0.004 0.080 05/13/2019
39 545373 UTSW Met 1.000 R7017 G1 225.01 Y 6 17491287 L16* T A nonsense Het probably null phenotype 05/13/2019
40 545385 UTSW Mpzl2 0.000 R7017 G1 225.01 Y 9 45047289 D108Y G T missense Het probably benign 0.213 phenotype 05/13/2019
41 545380 UTSW Mrgprb2 0.000 R7017 G1 225.01 Y 7 48552837 I47F T A missense Het probably benign 0.077 phenotype 05/13/2019
42 545382 UTSW Muc5ac 0.000 R7017 G1 225.01 N 7 141809687 G C intron Het probably benign phenotype 05/13/2019
43 545362 UTSW Mybphl 0.062 R7017 G1 225.01 Y 3 108374838 V128E T A missense Het probably damaging 0.989 phenotype 05/13/2019
44 545347 UTSW Nckap5 0.000 R7017 G1 225.01 Y 1 126102661 D231E A T missense Het probably damaging 1.000 0.061 05/13/2019
45 545349 UTSW Olfr1000 0.055 R7017 G1 225.01 Y 2 85608329 M194L T A missense Het probably benign 0.000 0.090 phenotype 05/13/2019
46 545367 UTSW Orm1 0.047 R7017 G1 225.01 Y 4 63345211 I87K T A missense Het probably benign 0.000 phenotype 05/13/2019
47 545419 UTSW Pdgfrb 1.000 R7017 G1 225.01 Y 18 61081004 P954S C T missense Het probably benign 0.004 phenotype 05/13/2019
48 545421 UTSW Pdzd8 0.000 R7017 G1 225.01 Y 19 59345352 S79* G T nonsense Het probably null 0.976 05/13/2019
49 545381 UTSW Pdzd9 0.065 R7017 G1 225.01 Y 7 120663002 H79L T A missense Het probably benign 0.226 05/13/2019
50 545352 UTSW Plcg1 1.000 R7017 G1 225.01 Y 2 160758097 I926F A T missense Het probably damaging 0.999 0.309 phenotype 05/13/2019
51 545406 UTSW Plec 0.751 R7017 G1 225.01 Y 15 76173541 F4078L A T missense Het probably damaging 0.998 phenotype 05/13/2019
52 545391 UTSW Plek 0.165 R7017 G1 225.01 Y 11 17052220 G A start gained Het probably benign phenotype 05/13/2019
53 545361 UTSW Pogz 0.675 R7017 G1 225.01 Y 3 94854024 I25T T C missense Het probably damaging 0.992 phenotype 05/13/2019
54 545379 UTSW Ppfia3 0.658 R7017 G1 225.01 Y 7 45358800 D215E A T missense Het probably benign 0.000 phenotype 05/13/2019
55 545378 UTSW Psg22 0.053 R7017 G1 225.01 Y 7 18724441 S352R C A missense Het probably benign 0.012 05/13/2019
56 545416 UTSW Ptchd4 0.057 R7017 G1 225.01 Y 17 42502735 Y509C A G missense Het probably damaging 0.999 05/13/2019
57 545351 UTSW Ralgapb 1.000 R7017 G1 225.01 Y 2 158448337 N389K C A missense Het probably benign 0.191 0.079 05/13/2019
58 545390 UTSW Rdh1 0.071 R7017 G1 225.01 Y 10 127763037 D129G A G missense Het probably benign 0.019 phenotype 05/13/2019
59 545409 UTSW Rimbp3 0.207 R7017 G1 225.01 Y 16 17209746 T345A A G missense Het probably benign 0.038 phenotype 05/13/2019
60 545360 UTSW S100a14 0.161 R7017 G1 225.01 Y 3 90527295 T C critical splice donor site 2 bp Het probably null phenotype 05/13/2019
61 545400 UTSW Scamp1 0.000 R7017 G1 225.01 Y 13 94224915 R152S T A missense Het probably damaging 0.976 phenotype 05/13/2019
62 545369 UTSW Slc30a2 0.129 R7017 G1 225.01 Y 4 134347415 R161Q G A missense Het probably damaging 1.000 phenotype 05/13/2019
63 545417 UTSW Srf 1.000 R7017 G1 225.01 Y 17 46550904 T383A T C missense Het probably benign 0.183 phenotype 05/13/2019
64 545363 UTSW St6galnac5 0.061 R7017 G1 225.01 Y 3 152846403 M176V T C missense Het probably damaging 0.992 0.462 phenotype 05/13/2019
65 545376 UTSW St8sia1 0.054 R7017 G1 225.01 Y 6 142867906 V177F C A missense Het probably damaging 0.983 phenotype 05/13/2019
66 568433 UTSW Syt12 0.000 R7017 G1 225.01 Y 19 4460867 C T splice site Het probably null phenotype 07/19/2019
67 545394 UTSW Tanc2 1.000 R7017 G1 225.01 Y 11 105923108 I1793V A G missense Het probably benign 0.000 phenotype 05/13/2019
68 545375 UTSW Tas2r123 0.050 R7017 G1 225.01 Y 6 132847550 I137V A G missense Het probably benign 0.001 05/13/2019
69 545392 UTSW Tenm2 0.471 R7017 G1 225.01 Y 11 36171409 Y543F T A missense Het probably damaging 0.975 phenotype 05/13/2019
70 545366 UTSW Tgfbr1 1.000 R7017 G1 225.01 Y 4 47410728 I488T T C missense Het probably damaging 0.988 phenotype 05/13/2019
71 545405 UTSW Tgm1 0.906 R7017 G1 225.01 Y 14 55704941 Y651F T A missense Het possibly damaging 0.757 phenotype 05/13/2019
72 545359 UTSW Thbs3 0.574 R7017 G1 225.01 Y 3 89224415 D698V A T missense Het probably damaging 1.000 phenotype 05/13/2019
73 545374 UTSW Tpra1 0.083 R7017 G1 225.01 Y 6 88908312 I82N T A missense Het probably damaging 1.000 05/13/2019
74 545370 UTSW Ubr4 1.000 R7017 G1 225.01 Y 4 139393090 D275E T A missense Het probably damaging 0.993 phenotype 05/13/2019
75 545414 UTSW Vmn2r111 0.086 R7017 G1 222 Y 17 22559051 N549S T C missense Het possibly damaging 0.502 0.179 05/13/2019
76 545364 UTSW Wwp1 0.000 R7017 G1 225.01 Y 4 19623124 Y787C T C missense Het probably damaging 1.000 phenotype 05/13/2019
77 545353 UTSW Znfx1 0.000 R7017 G1 225.01 Y 2 167048534 S677G T C missense Het probably damaging 1.000 0.232 05/13/2019
[records 1 to 77 of 77]