Incidental Mutations

77 incidental mutations are currently displayed, and affect 77 genes.
11 are Possibly Damaging.
25 are Probably Damaging.
29 are Probably Benign.
9 are Probably Null.
4 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 77 of 77] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 545415 UTSW 2410137M14Rik 0.060 R7017 G1 225.01 Y 17 36978034 A G utr 3 prime Het probably benign 05/13/2019
2 545396 UTSW Acot3 0.082 R7017 G1 156.01 Y 12 84053303 A T start gained Het probably benign 05/13/2019
3 545420 UTSW Add3 0.000 R7017 G1 225.01 Y 19 53233853 V297E T A missense Het possibly damaging 0.938 phenotype 05/13/2019
4 568432 UTSW Arfgap1 0.467 R7017 G1 225.01 Y 2 180976304 C G splice site Het probably null phenotype 07/19/2019
5 545371 UTSW C530008M17Rik 0.000 R7017 G1 199.47 N 5 76856948 GAGGCAGCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GAGACAACGCGAGGCCGAGAGGCAGG small deletion Het probably benign 05/13/2019
6 545407 UTSW Cacna1i 0.000 R7017 G1 225.01 Y 15 80380470 F1500L T C missense Het probably damaging 0.998 phenotype 05/13/2019
7 545348 UTSW Cacna1s 1.000 R7017 G1 225.01 Y 1 136095858 I945T T C missense Het probably damaging 0.994 0.919 phenotype 05/13/2019
8 545365 UTSW Ccdc180 0.000 R7017 G1 225.01 Y 4 45940934 N1334K T A missense Het possibly damaging 0.842 phenotype 05/13/2019
9 545358 UTSW Cd5l 0.000 R7017 G1 225.01 Y 3 87366061 Y112* C A nonsense Het probably null phenotype 05/13/2019
10 545408 UTSW Cyp2d40 0.114 R7017 G1 225.01 Y 15 82760033 F297Y A T missense Het unknown 05/13/2019
11 545401 UTSW Ddx4 0.676 R7017 G1 225.01 Y 13 112601488 V546I C T missense Het probably damaging 0.997 phenotype 05/13/2019
12 545410 UTSW Dgkg 0.116 R7017 G1 225.01 Y 16 22572713 M332V T C missense Het probably benign 0.308 phenotype 05/13/2019
13 545403 UTSW Dnah12 0.318 R7017 G1 225.01 Y 14 26735680 I867T T C missense Het probably benign 0.000 05/13/2019
14 545393 UTSW Dnah2 0.000 R7017 G1 225.01 Y 11 69491547 K1246* T A nonsense Het probably null phenotype 05/13/2019
15 545386 UTSW Drd2 0.350 R7017 G1 225.01 Y 9 49400829 V161I G A missense Het probably benign 0.325 phenotype 05/13/2019
16 545399 UTSW Dsp 1.000 R7017 G1 225.01 Y 13 38186707 D862G A G missense Het probably benign 0.016 phenotype 05/13/2019
17 545372 UTSW Ephx4 0.209 R7017 G1 225.01 Y 5 107406114 F10S T C missense Het probably damaging 0.980 05/13/2019
18 545354 UTSW Fabp9 0.128 R7017 G1 225.01 Y 3 10194696 A76S C A missense Het possibly damaging 0.952 phenotype 05/13/2019
19 545388 UTSW Fam198a 0.052 R7017 G1 225.01 Y 9 121965986 T C critical splice donor site 2 bp Het probably null 05/13/2019
20 545368 UTSW Fam46b 0.202 R7017 G1 225.01 Y 4 133486234 S139P T C missense Het possibly damaging 0.953 05/13/2019
21 545356 UTSW Fat4 1.000 R7017 G1 225.01 Y 3 38891543 M1528I G A missense Het probably benign 0.000 phenotype 05/13/2019
22 545384 UTSW Fbxl12 0.000 R7017 G1 225.01 Y 9 20618320 S84P A G missense Het unknown phenotype 05/13/2019
23 545412 UTSW Fbxo40 0.115 R7017 G1 225.01 Y 16 36970370 D126G T C missense Het probably damaging 1.000 phenotype 05/13/2019
24 545413 UTSW Fpr1 0.000 R7017 G1 225.01 Y 17 17877392 V112I C T missense Het probably benign 0.002 phenotype 05/13/2019
25 545357 UTSW Frem2 1.000 R7017 G1 225.01 Y 3 53519602 N2975S T C missense Het probably benign 0.018 phenotype 05/13/2019
26 545404 UTSW Gm7945 R7017 G1 146.01 N 14 41383653 Y156C T C missense Het 05/13/2019
27 545383 UTSW Gnpat 0.310 R7017 G1 225.01 Y 8 124863275 V13A T C missense Het probably benign 0.326 phenotype 05/13/2019
28 545398 UTSW Gpx5 0.000 R7017 G1 225.01 Y 13 21291391 P55L G A missense Het probably damaging 0.997 phenotype 05/13/2019
29 545395 UTSW Hbp1 0.817 R7017 G1 225.01 Y 12 31943853 S59P A G missense Het probably damaging 0.996 phenotype 05/13/2019
30 545397 UTSW Ighv1-36 0.161 R7017 G1 225.01 Y 12 114879913 D109V T A missense Het probably damaging 1.000 05/13/2019
31 545387 UTSW Iqcf5 0.061 R7017 G1 225.01 Y 9 106515664 I40N T A missense Het possibly damaging 0.897 05/13/2019
32 545402 UTSW Kcnma1 0.854 R7017 G1 225.01 Y 14 23494643 I484L T G missense Het possibly damaging 0.791 phenotype 05/13/2019
33 545389 UTSW Kera 0.000 R7017 G1 225.01 Y 10 97609077 R99S A T missense Het possibly damaging 0.790 phenotype 05/13/2019
34 545350 UTSW Kif3b 1.000 R7017 G1 225.01 Y 2 153329724 S707R T A missense Het possibly damaging 0.873 0.179 phenotype 05/13/2019
35 545377 UTSW Lilra6 0.103 R7017 G1 225.01 Y 7 3908708 T317N G T missense Het possibly damaging 0.928 0.179 05/13/2019
36 545411 UTSW Lrrc15 0.000 R7017 G1 225.01 Y 16 30272962 E520K C T missense Het probably benign 0.001 05/13/2019
37 545355 UTSW Lrrc34 0.061 R7017 G1 225.01 Y 3 30645316 C T critical splice acceptor site Het probably null 05/13/2019
38 545418 UTSW Lvrn 0.594 R7017 G1 225.01 Y 18 46850678 T163A A G missense Het probably benign 0.004 0.080 05/13/2019
39 545373 UTSW Met 1.000 R7017 G1 225.01 Y 6 17491287 L16* T A nonsense Het probably null phenotype 05/13/2019
40 545385 UTSW Mpzl2 0.000 R7017 G1 225.01 Y 9 45047289 D108Y G T missense Het probably benign 0.213 phenotype 05/13/2019
41 545380 UTSW Mrgprb2 0.000 R7017 G1 225.01 Y 7 48552837 I47F T A missense Het probably benign 0.077 phenotype 05/13/2019
42 545382 UTSW Muc5ac 0.000 R7017 G1 225.01 N 7 141809687 G C intron Het probably benign phenotype 05/13/2019
43 545362 UTSW Mybphl 0.079 R7017 G1 225.01 Y 3 108374838 V128E T A missense Het probably damaging 0.989 phenotype 05/13/2019
44 545347 UTSW Nckap5 0.000 R7017 G1 225.01 Y 1 126102661 D231E A T missense Het probably damaging 1.000 0.061 05/13/2019
45 545349 UTSW Olfr1000 0.066 R7017 G1 225.01 Y 2 85608329 M194L T A missense Het probably benign 0.000 0.090 phenotype 05/13/2019
46 545367 UTSW Orm1 0.056 R7017 G1 225.01 Y 4 63345211 I87K T A missense Het probably benign 0.000 phenotype 05/13/2019
47 545419 UTSW Pdgfrb 1.000 R7017 G1 225.01 Y 18 61081004 P954S C T missense Het probably benign 0.004 phenotype 05/13/2019
48 545421 UTSW Pdzd8 0.000 R7017 G1 225.01 Y 19 59345352 S79* G T nonsense Het probably null 0.976 05/13/2019
49 545381 UTSW Pdzd9 0.079 R7017 G1 225.01 Y 7 120663002 H79L T A missense Het probably benign 0.226 05/13/2019
50 545352 UTSW Plcg1 1.000 R7017 G1 225.01 Y 2 160758097 I926F A T missense Het probably damaging 0.999 0.309 phenotype 05/13/2019
51 545406 UTSW Plec 0.844 R7017 G1 225.01 Y 15 76173541 F4078L A T missense Het probably damaging 0.998 phenotype 05/13/2019
52 545391 UTSW Plek 0.170 R7017 G1 225.01 Y 11 17052220 G A start gained Het probably benign phenotype 05/13/2019
53 545361 UTSW Pogz 0.767 R7017 G1 225.01 Y 3 94854024 I25T T C missense Het probably damaging 0.992 phenotype 05/13/2019
54 545379 UTSW Ppfia3 0.735 R7017 G1 225.01 Y 7 45358800 D215E A T missense Het probably benign 0.000 phenotype 05/13/2019
55 545378 UTSW Psg22 0.058 R7017 G1 225.01 Y 7 18724441 S352R C A missense Het probably benign 0.012 05/13/2019
56 545416 UTSW Ptchd4 0.064 R7017 G1 225.01 Y 17 42502735 Y509C A G missense Het probably damaging 0.999 05/13/2019
57 545351 UTSW Ralgapb 1.000 R7017 G1 225.01 Y 2 158448337 N389K C A missense Het probably benign 0.191 0.079 05/13/2019
58 545390 UTSW Rdh1 0.074 R7017 G1 225.01 Y 10 127763037 D129G A G missense Het probably benign 0.019 phenotype 05/13/2019
59 545409 UTSW Rimbp3 0.246 R7017 G1 225.01 Y 16 17209746 T345A A G missense Het probably benign 0.038 phenotype 05/13/2019
60 545360 UTSW S100a14 0.120 R7017 G1 225.01 Y 3 90527295 T C critical splice donor site 2 bp Het probably null phenotype 05/13/2019
61 545400 UTSW Scamp1 0.000 R7017 G1 225.01 Y 13 94224915 R152S T A missense Het probably damaging 0.976 phenotype 05/13/2019
62 545369 UTSW Slc30a2 0.150 R7017 G1 225.01 Y 4 134347415 R161Q G A missense Het probably damaging 1.000 phenotype 05/13/2019
63 545417 UTSW Srf 1.000 R7017 G1 225.01 Y 17 46550904 T383A T C missense Het probably benign 0.183 phenotype 05/13/2019
64 545363 UTSW St6galnac5 0.079 R7017 G1 225.01 Y 3 152846403 M176V T C missense Het probably damaging 0.992 0.462 phenotype 05/13/2019
65 545376 UTSW St8sia1 0.065 R7017 G1 225.01 Y 6 142867906 V177F C A missense Het probably damaging 0.983 phenotype 05/13/2019
66 568433 UTSW Syt12 0.000 R7017 G1 225.01 Y 19 4460867 C T intron Het probably null phenotype 07/19/2019
67 545394 UTSW Tanc2 1.000 R7017 G1 225.01 Y 11 105923108 I1793V A G missense Het probably benign 0.000 phenotype 05/13/2019
68 545375 UTSW Tas2r123 0.055 R7017 G1 225.01 Y 6 132847550 I137V A G missense Het probably benign 0.001 05/13/2019
69 545392 UTSW Tenm2 0.707 R7017 G1 225.01 Y 11 36171409 Y543F T A missense Het probably damaging 0.975 phenotype 05/13/2019
70 545366 UTSW Tgfbr1 1.000 R7017 G1 225.01 Y 4 47410728 I488T T C missense Het probably damaging 0.988 phenotype 05/13/2019
71 545405 UTSW Tgm1 0.884 R7017 G1 225.01 Y 14 55704941 Y651F T A missense Het possibly damaging 0.757 phenotype 05/13/2019
72 545359 UTSW Thbs3 0.841 R7017 G1 225.01 Y 3 89224415 D698V A T missense Het probably damaging 1.000 phenotype 05/13/2019
73 545374 UTSW Tpra1 0.083 R7017 G1 225.01 Y 6 88908312 I82N T A missense Het probably damaging 1.000 05/13/2019
74 545370 UTSW Ubr4 1.000 R7017 G1 225.01 Y 4 139393090 D275E T A missense Het probably damaging 0.993 phenotype 05/13/2019
75 545414 UTSW Vmn2r111 0.107 R7017 G1 222 Y 17 22559051 N549S T C missense Het possibly damaging 0.502 0.179 05/13/2019
76 545364 UTSW Wwp1 0.000 R7017 G1 225.01 Y 4 19623124 Y787C T C missense Het probably damaging 1.000 phenotype 05/13/2019
77 545353 UTSW Znfx1 0.000 R7017 G1 225.01 Y 2 167048534 S677G T C missense Het probably damaging 1.000 0.232 05/13/2019
[records 1 to 77 of 77]