Incidental Mutations

62 incidental mutations are currently displayed, and affect 61 genes.
8 are Possibly Damaging.
25 are Probably Damaging.
19 are Probably Benign.
7 are Probably Null.
2 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 62 of 62] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 545533 UTSW Abat 1.000 R7019 G1 225.01 Y 16 8618531 K414* A T nonsense Het probably null phenotype 05/13/2019
2 545493 UTSW Aco1 0.455 R7019 G1 225.01 Y 4 40186376 I596N T A missense Het probably damaging 0.999 0.968 phenotype 05/13/2019
3 545537 UTSW Adgre1 0.231 R7019 G1 225.01 Y 17 57410945 D319A A C missense Het probably damaging 0.975 phenotype 05/13/2019
4 545525 UTSW BC067074 0.292 R7019 G1 225.01 Y 13 113351750 T102I C T missense Het probably benign 0.008 05/13/2019
5 545538 UTSW Birc6 1.000 R7019 G1 225.01 Y 17 74609345 V445A T C missense Het probably benign 0.013 phenotype 05/13/2019
6 545526 UTSW Btd 0.105 R7019 G1 225.01 Y 14 31667105 Q261P A C missense Het probably damaging 1.000 phenotype 05/13/2019
7 545527 UTSW Btd 0.105 R7019 G1 225.01 Y 14 31667106 Q261H G T missense Het possibly damaging 0.882 phenotype 05/13/2019
8 545530 UTSW C7 0.000 R7019 G1 225.01 Y 15 5045682 Y176F T A missense Het probably benign 0.044 phenotype 05/13/2019
9 545511 UTSW Ccdc102a 0.103 R7019 G1 225.01 Y 8 94909803 S287G T C missense Het probably benign 0.423 05/13/2019
10 545540 UTSW Ccdc178 0.000 R7019 G1 225.01 Y 18 22150438 T12S T A missense Het probably benign 0.001 05/13/2019
11 545505 UTSW Cnga4 0.086 R7019 G1 225.01 Y 7 105405829 A104S G T missense Het probably benign 0.004 phenotype 05/13/2019
12 545516 UTSW Col10a1 0.121 R7019 G1 225.01 Y 10 34394951 L306F G T missense Het probably damaging 0.961 phenotype 05/13/2019
13 545536 UTSW Cpne5 0.000 R7019 G1 225.01 Y 17 29226222 D36G T C missense Het probably damaging 1.000 phenotype 05/13/2019
14 545495 UTSW Csmd2 0.108 R7019 G1 225.01 Y 4 128369063 D681N G A missense Het 05/13/2019
15 545490 UTSW Cstl1 0.079 R7019 G1 225.01 Y 2 148755303 M75V A G missense Het probably benign 0.030 phenotype 05/13/2019
16 545543 UTSW Cyp26a1 1.000 R7019 G1 203.01 Y 19 37698812 L149P T C missense Het probably damaging 1.000 phenotype 05/13/2019
17 545499 UTSW D630045J12Rik 0.000 R7019 G1 225.01 Y 6 38194635 E866A T G missense Het probably benign 0.119 phenotype 05/13/2019
18 545514 UTSW Dlec1 0.000 R7019 G1 225.01 Y 9 119112422 P292L C T missense Het probably benign 0.015 0.112 phenotype 05/13/2019
19 545542 UTSW Dpp3 0.311 R7019 G1 225.01 Y 19 4916789 E402A T G missense Het possibly damaging 0.833 phenotype 05/13/2019
20 568439 UTSW Egf 0.000 R7019 G1 225.01 Y 3 129718064 T C splice site Het probably null phenotype 07/24/2019
21 545497 UTSW Epha5 0.000 R7019 G1 225.01 Y 5 84416462 Q15R T C missense Het possibly damaging 0.682 0.179 phenotype 05/13/2019
22 545513 UTSW Esyt3 0.000 R7019 G1 225.01 Y 9 99315285 F831L A G missense Het probably benign 0.108 0.188 phenotype 05/13/2019
23 545524 UTSW Fam50b 0.074 R7019 G1 225.01 Y 13 34747101 E187K G A missense Het possibly damaging 0.892 0.157 phenotype 05/13/2019
24 545488 UTSW Fut7 0.196 R7019 G1 225.01 Y 2 25425780 D350G A G missense Het probably benign 0.003 phenotype 05/13/2019
25 545509 UTSW Gab1 1.000 R7019 G1 225.01 Y 8 80784817 E466D C A missense Het probably damaging 0.994 phenotype 05/13/2019
26 545484 UTSW Glrp1 0.074 R7019 G1 225.01 Y 1 88503168 M160K A T missense Het unknown 05/13/2019
27 545498 UTSW Gngt1 0.000 R7019 G1 225.01 Y 6 3994088 T C critical splice donor site 2 bp Het probably null phenotype 05/13/2019
28 545517 UTSW Gprc6a 0.000 R7019 G1 225.01 Y 10 51631412 V7E A T missense Het possibly damaging 0.675 phenotype 05/13/2019
29 545489 UTSW Idh3b 0.000 R7019 G1 225.01 Y 2 130280966 V301D A T missense Het probably damaging 1.000 0.907 phenotype 05/13/2019
30 545486 UTSW Ifi202b 0.053 R7019 G1 225.01 Y 1 173963958 C385G A C missense Het probably benign 0.003 0.090 05/13/2019
31 545518 UTSW Ilvbl 0.112 R7019 G1 225.01 Y 10 78579086 L261Q T A missense Het probably damaging 0.960 phenotype 05/13/2019
32 545510 UTSW Irx6 0.118 R7019 G1 225.01 Y 8 92678734 L410Q T A missense Het probably damaging 0.991 phenotype 05/13/2019
33 545523 UTSW Ism2 0.000 R7019 G1 225.01 Y 12 87299663 M15V T C missense Het unknown 0.087 05/13/2019
34 545487 UTSW Itih5 0.062 R7019 G1 225.01 Y 2 10190327 R177S C A missense Het probably damaging 0.998 phenotype 05/13/2019
35 545500 UTSW Klra3 0.051 R7019 G1 225.01 Y 6 130327124 G202R C T missense Het probably damaging 1.000 05/13/2019
36 545532 UTSW Krt7 0.000 R7019 G1 225.01 Y 15 101413970 V103A T C missense Het probably damaging 1.000 phenotype 05/13/2019
37 545539 UTSW Lama3 1.000 R7019 G1 225.01 Y 18 12528418 S2145P T C missense Het probably damaging 0.970 phenotype 05/13/2019
38 545485 UTSW Mlph 0.121 R7019 G1 225.01 Y 1 90941706 R477G A G missense Het probably damaging 0.999 phenotype 05/13/2019
39 545519 UTSW Mybpc1 0.781 R7019 G1 225.01 Y 10 88543719 L653F T A missense Het probably damaging 1.000 phenotype 05/13/2019
40 545520 UTSW Myrfl 0.000 R7019 G1 225.01 Y 10 116781947 A G critical splice donor site 2 bp Het probably null 05/13/2019
41 545515 UTSW Myrip 0.000 R7019 G1 225.01 Y 9 120422507 L232R T G missense Het probably damaging 1.000 0.442 05/13/2019
42 545494 UTSW Nrd1 0.214 R7019 G1 225.01 Y 4 109028802 H126L A T missense Het probably benign 0.329 phenotype 05/13/2019
43 545512 UTSW Olfr251 0.076 R7019 G1 225.01 Y 9 38378802 L307Q T A missense Het possibly damaging 0.892 phenotype 05/13/2019
44 545506 UTSW Olfr469 0.125 R7019 G1 225.01 Y 7 107823158 L104I G T missense Het probably benign 0.042 phenotype 05/13/2019
45 545528 UTSW Olfr722 0.065 R7019 G1 225.01 Y 14 49895667 I45N A T missense Het probably damaging 1.000 phenotype 05/13/2019
46 545541 UTSW Pcdhb10 0.094 R7019 G1 225.01 Y 18 37413003 N377K T A missense Het probably damaging 1.000 phenotype 05/13/2019
47 545491 UTSW Pigt 0.834 R7019 G1 214.46 Y 2 164499669 CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT frame shift Het probably null phenotype 05/13/2019
48 545534 UTSW Prkdc 0.957 R7019 G1 225.01 Y 16 15769966 I2572L A C missense Het probably benign 0.003 phenotype 05/13/2019
49 545501 UTSW Ptpro 0.000 R7019 G1 225.01 Y 6 137380478 D322E C A missense Het probably benign 0.000 phenotype 05/13/2019
50 545529 UTSW R3hcc1 0.101 R7019 G1 225.01 Y 14 69704125 I332T A G missense Het probably damaging 0.999 0.394 05/13/2019
51 545508 UTSW Rab8a 0.264 R7019 G1 225.01 Y 8 72161383 F9L T C missense Het probably damaging 0.976 0.214 phenotype 05/13/2019
52 545531 UTSW Ranbp3l 0.095 R7019 G1 225.01 Y 15 9057160 K165N A T missense Het probably damaging 0.993 05/13/2019
53 545521 UTSW Rock2 0.834 R7019 G1 225.01 Y 12 16977740 C1353S T A missense Het probably damaging 1.000 0.955 phenotype 05/13/2019
54 545522 UTSW Rsad2 0.000 R7019 G1 225.01 Y 12 26456419 M1L T A start codon destroyed Het possibly damaging 0.886 phenotype 05/13/2019
55 568440 UTSW Tymp 0.000 R7019 G1 225.01 Y 15 89376281 A T synonymous Het probably null phenotype 07/24/2019
56 545503 UTSW Vmn1r104 R7019 G1 132.01 N 7 20534566 M244V A G missense Het probably benign 0.073 05/13/2019
57 545535 UTSW Vmn1r232 0.056 R7019 G1 225.01 Y 17 20913285 T351M G A missense Het possibly damaging 0.759 05/13/2019
58 545502 UTSW Vmn2r50 0.098 R7019 G1 225.01 Y 7 10050245 Y101H A G missense Het probably benign 0.006 0.090 05/13/2019
59 545504 UTSW Vmn2r57 0.146 R7019 G1 225.01 Y 7 41428665 L123P A G missense Het probably damaging 0.999 0.647 05/13/2019
60 545507 UTSW Wdr17 0.000 R7019 G1 225.01 Y 8 54681453 N331D T C missense Het probably damaging 0.998 phenotype 05/13/2019
61 545492 UTSW Wdr47 0.000 R7019 G1 225.01 Y 3 108614355 Q89* C T nonsense Het probably null 05/13/2019
62 545496 UTSW Zcchc4 0.108 R7019 G1 225.01 Y 5 52784033 T57S A T missense Het probably benign 0.001 05/13/2019
[records 1 to 62 of 62]