Incidental Mutations

71 incidental mutations are currently displayed, and affect 70 genes.
15 are Possibly Damaging.
27 are Probably Damaging.
16 are Probably Benign.
11 are Probably Null.
3 create premature stop codons.
2 are critical splice junction mutations.
Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 71 of 71] per page Full List
 
 ID question?
 Source question?
 Gene question?
 E-score question?
  		Stock # question?
 Gen question?
 Quality
- 		Vld question?
 Strain question?
 Chr question?
 Position question?
 		 Mutation question?
 Ref
 Var
 Type question?
 Exon Dist question?
  		Zygosity question?
 Predicted Effect question?
 PPH Score question?
- 		Meta Score question?
  		MGI Phenotype question?
 Posted question?
 
1 546770 UTSW Acsm3 0.000 R7037 G1 225.01 Y 7 119768043 N33I A T missense Het probably damaging 0.998 phenotype 05/13/2019
2 546787 UTSW Ahnak2 0.059 R7037 G1 225.01 Y 12 112774278 V314D A T missense Het probably damaging 0.985 05/13/2019
3 546800 UTSW Arl14epl 0.202 R7037 G1 225.01 Y 18 46932443 C92G T G missense Het probably benign 0.384 05/13/2019
4 546739 UTSW Atp6v1h 1.000 R7037 G1 225.01 Y 1 5149992 M423K T A missense Het possibly damaging 0.766 phenotype 05/13/2019
5 546795 UTSW Baiap3 0.000 R7037 G1 225.01 Y 17 25243840 R1075C G A missense Het probably benign 0.000 0.090 phenotype 05/13/2019
6 546745 UTSW Baz2b 0.257 R7037 G1 225.01 Y 2 59933670 C T critical splice donor site 1 bp Het probably null 0.948 phenotype 05/13/2019
7 546797 UTSW Bicral 1.000 R7037 G1 225.01 Y 17 46824634 H550R T C missense Het probably benign 0.084 phenotype 05/13/2019
8 546765 UTSW C1rl 0.000 R7037 G1 225.01 Y 6 124508639 Y323C A G missense Het probably damaging 1.000 05/13/2019
9 546777 UTSW Ccr9 0.112 R7037 G1 225.01 Y 9 123779971 H239Q T A missense Het possibly damaging 0.522 phenotype 05/13/2019
10 546773 UTSW Cdh16 0.074 R7037 G1 225.01 Y 8 104617635 R91* T A nonsense Het probably null 0.976 phenotype 05/13/2019
11 546761 UTSW Coro1c 0.000 R7037 G1 225.01 Y 5 113845396 F357S A G missense Het possibly damaging 0.603 0.957 phenotype 05/13/2019
12 546762 UTSW Cpsf4 0.951 R7037 G1 225.01 Y 5 145176129 R141Q G A missense Het possibly damaging 0.512 phenotype 05/13/2019
13 546742 UTSW Cryzl2 0.000 R7037 G1 225.01 Y 1 157470748 V236I G A missense Het probably damaging 0.991 05/13/2019
14 546764 UTSW Cttnbp2 0.000 R7037 G1 225.01 Y 6 18435118 E247G T C missense Het probably damaging 1.000 phenotype 05/13/2019
15 568445 UTSW Dbr1 1.000 R7037 G1 225.01 Y 9 99576568 T A splice site Het probably null phenotype 07/31/2019
16 546752 UTSW Dclk1 0.678 R7037 G1 225.01 Y 3 55463048 S23P T C missense Het probably damaging 0.999 0.160 phenotype 05/13/2019
17 568443 UTSW Diexf 0.966 R7037 G1 225.01 Y 1 193120723 A C splice site Het probably null 07/31/2019
18 546755 UTSW Dpyd 0.000 R7037 G1 225.01 Y 3 118899289 I361F A T missense Het probably benign 0.003 phenotype 05/13/2019
19 546781 UTSW Elac2 1.000 R7037 G1 225.01 Y 11 64983711 E218G A G missense Het probably benign 0.000 phenotype 05/13/2019
20 546798 UTSW Eml4 0.902 R7037 G1 225.01 Y 17 83425327 D136E T A missense Het probably benign 0.044 phenotype 05/13/2019
21 546776 UTSW Fam198a 0.055 R7037 G1 225.01 Y 9 121965526 V249L G T missense Het possibly damaging 0.612 05/13/2019
22 546766 UTSW Fam71e2 0.089 R7037 G1 225.01 Y 7 4758585 G T utr 3 prime Het probably benign 05/13/2019
23 546774 UTSW Foxred1 1.000 R7037 G1 225.01 Y 9 35207548 S223T A T missense Het probably benign 0.039 phenotype 05/13/2019
24 546783 UTSW Gm11595 0.068 R7037 G1 225.01 N 11 99772648 C69R A G missense Het unknown 05/13/2019
25 546747 UTSW Gm14124 0.071 R7037 G1 225.01 Y 2 150266456 V46F G T missense Het possibly damaging 0.861 0.179 05/13/2019
26 546803 UTSW Gna14 0.144 R7037 G1 225.01 Y 19 16533764 H59L A T missense Het phenotype 05/13/2019
27 546796 UTSW H2-Ab1 0.080 R7037 G1 225.01 Y 17 34267989 I239N T A missense Het probably damaging 0.985 phenotype 05/13/2019
28 546743 UTSW Ints7 0.947 R7037 G1 225.01 Y 1 191619605 S809P T C missense Het probably benign 0.155 0.296 phenotype 05/13/2019
29 546785 UTSW Itgb4 1.000 R7037 G1 225.01 Y 11 116005565 Y1379* T A nonsense Het probably null phenotype 05/13/2019
30 546804 UTSW Kank1 0.000 R7037 G1 225.01 Y 19 25430341 D1233G A G missense Het probably damaging 0.999 phenotype 05/13/2019
31 546789 UTSW Kif13a 0.351 R7037 G1 225.01 Y 13 46752455 V671M C T missense Het possibly damaging 0.949 0.076 phenotype 05/13/2019
32 546759 UTSW Lrrc66 0.051 R7037 G1 225.01 Y 5 73607161 D846E A T missense Het probably benign 0.105 05/13/2019
33 546788 UTSW Lyst 0.239 R7037 G1 225.01 Y 13 13616666 H38R A G missense Het probably damaging 0.999 phenotype 05/13/2019
34 546751 UTSW Mc3r 0.150 R7037 G1 225.01 Y 2 172249634 F259L T C missense Het probably damaging 0.999 0.327 phenotype 05/13/2019
35 546767 UTSW Med25 1.000 R7037 G1 225.01 Y 7 44882782 Y384H A G missense Het probably damaging 0.998 phenotype 05/13/2019
36 546763 UTSW Met 1.000 R7037 G1 225.01 Y 6 17547128 A T intron Het probably benign phenotype 05/13/2019
37 546757 UTSW Mmp16 0.000 R7037 G1 225.01 Y 4 18116148 V584A T C missense Het possibly damaging 0.948 0.139 phenotype 05/13/2019
38 546786 UTSW Mpp5 0.666 R7037 G1 225.01 Y 12 78797199 I59N T A missense Het probably damaging 1.000 phenotype 05/13/2019
39 546768 UTSW Mrgprb3 0.084 R7037 G1 225.01 Y 7 48643194 L203P A G missense Het probably damaging 0.996 05/13/2019
40 546801 UTSW Mus81 0.262 R7037 G1 225.01 Y 19 5486080 L185P A G missense Het probably damaging 0.998 phenotype 05/13/2019
41 546760 UTSW Naaa 0.000 R7037 G1 225.01 Y 5 92277075 V75A A G missense Het possibly damaging 0.464 phenotype 05/13/2019
42 546779 UTSW Obscn 0.730 R7037 G1 225.01 Y 11 59043929 T5292S T A missense Het probably damaging 0.999 phenotype 05/13/2019
43 546780 UTSW Obscn 0.730 R7037 G1 104.01 Y 11 59052604 S4801G T C missense Het probably damaging 0.980 phenotype 05/13/2019
44 546769 UTSW Olfr703 0.150 R7037 G1 225.01 Y 7 106845336 S242P T C missense Het probably damaging 0.999 phenotype 05/13/2019
45 546758 UTSW Otof 0.147 R7037 G1 225.01 Y 5 30381538 D1112G T C missense Het probably benign 0.322 phenotype 05/13/2019
46 546772 UTSW Pbx4 0.265 R7037 G1 225.01 Y 8 69864875 R170G A G missense Het probably damaging 0.997 phenotype 05/13/2019
47 546749 UTSW Pigt 0.824 R7037 G1 214.46 Y 2 164499669 CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT frame shift Het probably null phenotype 05/13/2019
48 546805 UTSW Plce1 0.577 R7037 G1 225.01 Y 19 38702017 D715V A T missense Het probably damaging 1.000 0.236 phenotype 05/13/2019
49 546741 UTSW Pms1 0.000 R7037 G1 225.01 Y 1 53207611 T311A T C missense Het possibly damaging 0.950 phenotype 05/13/2019
50 546794 UTSW Popdc2 0.000 R7037 G1 225.01 Y 16 38374267 D350G A G missense Het probably damaging 1.000 0.161 phenotype 05/13/2019
51 546750 UTSW Prex1 0.216 R7037 G1 225.01 Y 2 166587180 V661A A G missense Het probably benign 0.049 0.090 phenotype 05/13/2019
52 546756 UTSW Ptbp2 1.000 R7037 G1 225.01 Y 3 119751908 Y130H A G missense Het probably damaging 0.998 phenotype 05/13/2019
53 546778 UTSW Rev3l 1.000 R7037 G1 225.01 Y 10 39851975 R2707W C T missense Het probably damaging 1.000 0.647 phenotype 05/13/2019
54 546792 UTSW Rpl37 0.958 R7037 G1 225.01 Y 15 5117703 R75K G A missense Het probably null 0.005 0.124 phenotype 05/13/2019
55 546746 UTSW Ryr3 0.436 R7037 G1 225.01 Y 2 112949130 R259* T A nonsense Het probably null 0.976 phenotype 05/13/2019
56 546744 UTSW Scai 0.500 R7037 G1 225.01 Y 2 39190621 S8T A T missense Het probably benign 0.039 phenotype 05/13/2019
57 546784 UTSW Scn4a 1.000 R7037 G1 225.01 Y 11 106320900 L1430F C A missense Het probably damaging 0.981 phenotype 05/13/2019
58 546793 UTSW Sema5a 1.000 R7037 G1 225.01 Y 15 32686847 K1035R A G missense Het probably damaging 0.999 0.146 phenotype 05/13/2019
59 546791 UTSW Siah3 0.161 R7037 G1 225.01 Y 14 75525585 H92R A G missense Het probably benign 0.007 05/13/2019
60 546753 UTSW Smc4 0.971 R7037 G1 225.01 Y 3 69018195 V342I G A missense Het possibly damaging 0.668 0.073 phenotype 05/13/2019
61 546790 UTSW Spata31d1a 0.052 R7037 G1 225.01 Y 13 59700324 C1330Y C T missense Het possibly damaging 0.956 0.179 05/13/2019
62 546740 UTSW St18 0.000 R7037 G1 225.01 Y 1 6803036 H332N C A missense Het possibly damaging 0.650 05/13/2019
63 546754 UTSW Sycp1 0.398 R7037 G1 225.01 Y 3 102898934 E480D T A missense Het possibly damaging 0.615 0.179 phenotype 05/13/2019
64 546782 UTSW Tex14 0.256 R7037 G1 225.01 Y 11 87497915 I323F A T missense Het probably damaging 0.997 phenotype 05/13/2019
65 546802 UTSW Tm7sf2 0.000 R7037 G1 225.01 Y 19 6064077 A T critical splice donor site 2 bp Het probably null phenotype 05/13/2019
66 546799 UTSW Tmem241 0.000 R7037 G1 225.01 Y 18 12113406 H62Q G T missense Het probably benign 0.024 0.090 05/13/2019
67 568444 UTSW Tmem54 0.060 R7037 G1 225.01 Y 4 129110801 T A splice site Het probably null 07/31/2019
68 546748 UTSW Tomm34 0.133 R7037 G1 225.01 Y 2 164070478 L39P A G missense Het probably damaging 0.998 0.343 phenotype 05/13/2019
69 546771 UTSW Triml2 0.067 R7037 G1 225.01 Y 8 43193536 V354D T A missense Het probably damaging 0.999 phenotype 05/13/2019
70 546775 UTSW Usp19 0.318 R7037 G1 225.01 Y 9 108496958 I738T T C missense Het possibly damaging 0.520 0.143 phenotype 05/13/2019
71 568446 UTSW Utrn 0.000 R7037 G1 225.01 Y 10 12826770 T A splice site Het probably null phenotype 07/31/2019
[records 1 to 71 of 71]