Incidental Mutations

55 incidental mutations are currently displayed, and affect 55 genes.
13 are Possibly Damaging.
20 are Probably Damaging.
17 are Probably Benign.
3 are Probably Null.
1 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 55 of 55] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 546999 UTSW 9130023H24Rik 0.108 R7040 G1 225.01 N 7 128236725 (GRCm38) L232P A G missense Het possibly damaging 0.641 2019-05-13
2 547005 UTSW Acaa1a 0.000 R7040 G1 149.01 N 9 119349038 (GRCm38) V312A T C missense Het probably damaging 1.000 phenotype 2019-05-13
3 546981 UTSW Bmp2 1.000 R7040 G1 225.01 N 2 133561684 (GRCm38) D385G A G missense Het probably damaging 0.999 phenotype 2019-05-13
4 547014 UTSW C1qtnf9 0.059 R7040 G1 225.01 N 14 60779792 (GRCm38) V257A T C missense Het probably damaging 1.000 phenotype 2019-05-13
5 547003 UTSW Cd3d 0.145 R7040 G1 225.01 N 9 44985693 (GRCm38) V122I G A missense Het probably damaging 1.000 phenotype 2019-05-13
6 547002 UTSW Cdc37 0.948 R7040 G1 225.01 N 9 21142223 (GRCm38) E199G T C missense Het probably damaging 1.000 phenotype 2019-05-13
7 546980 UTSW Crb2 1.000 R7040 G1 225.01 N 2 37787684 (GRCm38) D326E T A missense Het probably benign 0.323 phenotype 2019-05-13
8 547031 UTSW Cyp2c29 0.111 R7040 G1 225.01 N 19 39330337 (GRCm38) K420N A C missense Het possibly damaging 0.955 2019-05-13
9 546991 UTSW Cyp2g1 0.000 R7040 G1 225.01 N 7 26820759 (GRCm38) D472A A C missense Het probably damaging 0.991 phenotype 2019-05-13
10 547017 UTSW Dab2 0.905 R7040 G1 225.01 N 15 6422251 (GRCm38) H116P A C missense Het probably damaging 1.000 phenotype 2019-05-13
11 546979 UTSW Dnah7b 0.135 R7040 G1 225.01 N 1 46236809 (GRCm38) E2619Q G C missense Het probably benign 0.012 2019-05-13
12 547027 UTSW Dsg4 0.578 R7040 G1 225.01 N 18 20451852 (GRCm38) M208L A T missense Het probably benign 0.013 phenotype 2019-05-13
13 547009 UTSW Eif4enif1 0.406 R7040 G1 103.01 N 11 3234040 (GRCm38) V521G T G missense Het probably benign 0.332 phenotype 2019-05-13
14 546993 UTSW Fan1 0.000 R7040 G1 225.01 N 7 64372486 (GRCm38) N340Y T A missense Het probably damaging 0.974 0.101 phenotype 2019-05-13
15 547023 UTSW Fpr-rs6 0.130 R7040 G1 225.01 N 17 20182934 (GRCm38) M55T A G missense Het probably damaging 1.000 2019-05-13
16 546985 UTSW Grhpr 0.116 R7040 G1 225.01 N 4 44985362 (GRCm38) S101G A G missense Het probably damaging 0.998 phenotype 2019-05-13
17 547006 UTSW Kif15 0.000 R7040 G1 225.01 N 9 123011614 (GRCm38) D33E T A missense Het possibly damaging 0.672 2019-05-13
18 547019 UTSW Krt1 0.588 R7040 G1 214.46 N 15 101850378 (GRCm38) AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC small deletion Het probably benign 0.090 phenotype 2019-05-13
19 547007 UTSW Lama4 1.000 R7040 G1 225.01 N 10 39060162 (GRCm38) Q611R A G missense Het possibly damaging 0.693 phenotype 2019-05-13
20 546989 UTSW Lrrc47 0.143 R7040 G1 225.01 N 4 154020452 (GRCm38) *123R T A makesense Het probably null 2019-05-13
21 547026 UTSW Map4k3 0.000 R7040 G1 225.01 N 17 80680915 (GRCm38) V36G A C missense Het probably damaging 0.983 phenotype 2019-05-13
22 546984 UTSW Mme 0.000 R7040 G1 225.01 N 3 63368923 (GRCm38) I707N T A missense Het probably damaging 0.999 phenotype 2019-05-13
23 547000 UTSW Muc2 0.109 R7040 G1 225.01 N 7 141751457 (GRCm38) E166G A G missense Het unknown phenotype 2019-05-13
24 547020 UTSW Mucl1 0.060 R7040 G1 225.01 N 15 103753578 (GRCm38) T108S T A missense Het possibly damaging 0.659 2019-05-13
25 546990 UTSW Myo1h 1.000 R7040 G1 225.01 N 5 114359744 (GRCm38) D53V A T missense Het possibly damaging 0.671 2019-05-13
26 546983 UTSW Naa15 0.956 R7040 G1 225.01 N 3 51472784 (GRCm38) L811Q T A missense Het possibly damaging 0.895 phenotype 2019-05-13
27 547016 UTSW Nalcn 1.000 R7040 G1 225.01 N 14 123287855 (GRCm38) T1487A T C missense Het probably benign 0.000 phenotype 2019-05-13
28 547011 UTSW Nme8 0.114 R7040 G1 225.01 N 13 19694328 (GRCm38) L87H A T missense Het probably damaging 1.000 phenotype 2019-05-13
29 547008 UTSW Nr2e1 0.902 R7040 G1 225.01 N 10 42568378 (GRCm38) V245A A G missense Het probably damaging 0.994 phenotype 2019-05-13
30 547033 UTSW Nt5c2 0.253 R7040 G1 225.01 N 19 46893535 (GRCm38) F291Y A T missense Het possibly damaging 0.520 phenotype 2019-05-13
31 546987 UTSW Olfr1337 0.222 R7040 G1 225.01 N 4 118781986 (GRCm38) M200V T C missense Het probably benign 0.001 phenotype 2019-05-13
32 547013 UTSW Olfr1508 0.064 R7040 G1 225.01 N 14 52463475 (GRCm38) D178G T C missense Het possibly damaging 0.879 phenotype 2019-05-13
33 546995 UTSW Olfr556 0.138 R7040 G1 225.01 N 7 102670730 (GRCm38) Q270L A T missense Het probably benign 0.003 phenotype 2019-05-13
34 546996 UTSW Olfr668 0.211 R7040 G1 225.01 N 7 104925510 (GRCm38) C85S A T missense Het probably benign 0.021 phenotype 2019-05-13
35 547004 UTSW Ooep R7040 G1 225.01 N 9 78378401 (GRCm38) N43S T C missense Het possibly damaging 0.920 phenotype 2019-05-13
36 546997 UTSW Ovch2 0.000 R7040 G1 225.01 N 7 107796565 (GRCm38) I82N A T missense Het probably damaging 0.997 2019-05-13
37 546998 UTSW Palb2 1.000 R7040 G1 225.01 N 7 122114399 (GRCm38) M524K A T missense Het possibly damaging 0.881 phenotype 2019-05-13
38 546986 UTSW Patj 0.000 R7040 G1 225.01 N 4 98441080 (GRCm38) S524P T C missense Het probably benign 0.019 phenotype 2019-05-13
39 547030 UTSW Patl1 0.432 R7040 G1 225.01 N 19 11929954 (GRCm38) Y401N T A missense Het possibly damaging 0.945 2019-05-13
40 547028 UTSW Pcdhb20 0.064 R7040 G1 225.01 N 18 37504717 (GRCm38) T99S A T missense Het probably benign 0.001 phenotype 2019-05-13
41 546982 UTSW Plcb4 0.000 R7040 G1 225.01 N 2 135932262 (GRCm38) A155T G A missense Het probably benign 0.000 phenotype 2019-05-13
42 547018 UTSW Rpap3 1.000 R7040 G1 225.01 N 15 97679112 (GRCm38) V585A A G missense Het possibly damaging 0.511 phenotype 2019-05-13
43 547032 UTSW Sorbs1 0.766 R7040 G1 225.01 N 19 40376800 (GRCm38) R180G G C missense Het probably benign 0.000 0.090 phenotype 2019-05-13
44 546988 UTSW Spen 1.000 R7040 G1 225.01 N 4 141494382 (GRCm38) T302S T A missense Het unknown phenotype 2019-05-13
45 546994 UTSW Tenm4 1.000 R7040 G1 225.01 N 7 96553496 (GRCm38) R106H G A missense Het probably benign 0.011 0.090 phenotype 2019-05-13
46 547010 UTSW Ube2o 0.833 R7040 G1 204.01 N 11 116541860 (GRCm38) E760G T C missense Het probably benign 0.078 phenotype 2019-05-13
47 547012 UTSW Uimc1 0.279 R7040 G1 225.01 N 13 55075454 (GRCm38) T A splice site 1949 bp Het probably null phenotype 2019-05-13
48 547022 UTSW Usp16 1.000 R7040 G1 225.01 N 16 87480929 (GRCm38) A689V C T missense Het probably damaging 0.999 phenotype 2019-05-13
49 546992 UTSW Vmn2r60 0.084 R7040 G1 221.01 N 7 42142242 (GRCm38) A530T G A missense Het probably benign 0.003 2019-05-13
50 547021 UTSW Vps8 1.000 R7040 G1 225.01 N 16 21575022 (GRCm38) M1185K T A missense Het probably damaging 1.000 2019-05-13
51 547015 UTSW Vwa8 0.000 R7040 G1 225.01 N 14 78912205 (GRCm38) S136P T C missense Het probably damaging 1.000 2019-05-13
52 547029 UTSW Ythdc2 0.000 R7040 G1 225.01 N 18 44834462 (GRCm38) N175S A G missense Het probably benign 0.016 phenotype 2019-05-13
53 547024 UTSW Zfp160 0.000 R7040 G1 225.01 N 17 21026532 (GRCm38) H448L A T missense Het probably damaging 0.997 2019-05-13
54 547001 UTSW Zfp90 0.140 R7040 G1 225.01 N 8 106425009 (GRCm38) C451* T A nonsense Het probably null phenotype 2019-05-13
55 547025 UTSW Zfp945 0.065 R7040 G1 225.01 N 17 22852290 (GRCm38) C212R A G missense Het probably damaging 0.975 2019-05-13
[records 1 to 55 of 55]