Incidental Mutations

55 incidental mutations are currently displayed, and affect 55 genes.
10 are Possibly Damaging.
22 are Probably Damaging.
13 are Probably Benign.
8 are Probably Null.
3 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 55 of 55] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 547715 UTSW Adam26a 0.000 R7053 G1 225.01 N 8 43568799 C551* A T nonsense Het probably null phenotype 05/13/2019
2 547707 UTSW Aldh1l1 0.000 R7053 G1 225.01 N 6 90563438 T235K C A missense Het possibly damaging 0.503 phenotype 05/13/2019
3 547703 UTSW Atp6v0a2 0.177 R7053 G1 225.01 N 5 124645983 E257G A G missense Het probably damaging 0.997 phenotype 05/13/2019
4 547708 UTSW AW146154 0.080 R7053 G1 225.01 N 7 41482564 A G critical splice donor site 2 bp Het probably null 05/13/2019
5 547734 UTSW BC048507 0.389 R7053 G1 225.01 N 13 67863653 Y50H T C missense Het probably benign 0.062 05/13/2019
6 547725 UTSW Brip1 0.000 R7053 G1 225.01 N 11 86192965 N77D T C missense Het possibly damaging 0.528 phenotype 05/13/2019
7 547720 UTSW Ccdc13 0.072 R7053 G1 225.01 N 9 121833838 E37G T C missense Het probably damaging 0.966 05/13/2019
8 547697 UTSW Col27a1 1.000 R7053 G1 209.01 N 4 63333167 T A utr 3 prime Het probably benign phenotype 05/13/2019
9 547700 UTSW Corin 0.219 R7053 G1 225.01 N 5 72301527 I960L T A missense Het probably benign 0.279 phenotype 05/13/2019
10 547745 UTSW Csnk2b R7053 G1 225.01 N 17 35116446 A G intron Het probably benign phenotype 05/13/2019
11 547739 UTSW Cyp2d26 0.081 R7053 G1 225.01 N 15 82792600 S182G T C missense Het probably benign 0.003 05/13/2019
12 547694 UTSW Dennd1a 0.727 R7053 G1 225.01 N 2 37961654 L74P A G missense Het probably damaging 1.000 phenotype 05/13/2019
13 547733 UTSW Dip2c 0.724 R7053 G1 225.01 N 13 9610704 D838G A G missense Het probably damaging 0.998 phenotype 05/13/2019
14 547710 UTSW Dkkl1 0.000 R7053 G1 225.01 N 7 45207598 Q182K G T missense Het probably damaging 0.997 phenotype 05/13/2019
15 547728 UTSW Dnaic2 0.104 R7053 G1 225.01 N 11 114738695 S183P T C missense Het probably damaging 1.000 phenotype 05/13/2019
16 547712 UTSW Dnhd1 0.090 R7053 G1 225.01 N 7 105694954 L1835P T C missense Het probably damaging 1.000 05/13/2019
17 547740 UTSW Espl1 1.000 R7053 G1 225.01 N 15 102316893 T C critical splice donor site 2 bp Het probably null phenotype 05/13/2019
18 547711 UTSW Fam160a2 0.000 R7053 G1 225.01 N 7 105384572 G479D C T missense Het probably damaging 1.000 phenotype 05/13/2019
19 547693 UTSW Fam174a 0.060 R7053 G1 225.01 N 1 95325228 A185V C T missense Het probably damaging 0.960 05/13/2019
20 547714 UTSW Gm40460 R7053 G1 148.46 N 7 142240817 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG small deletion Het probably benign 05/13/2019
21 547706 UTSW Grid2 0.000 R7053 G1 225.01 N 6 64700418 A74S G T missense Het unknown phenotype 05/13/2019
22 547727 UTSW Gsdma3 0.104 R7053 G1 225.01 N 11 98629795 M84K T A missense Het possibly damaging 0.752 phenotype 05/13/2019
23 547741 UTSW Hlcs 1.000 R7053 G1 225.01 N 16 94268015 S262R A T missense Het possibly damaging 0.911 phenotype 05/13/2019
24 547722 UTSW Lrp1 1.000 R7053 G1 225.01 N 10 127541094 C4205R A G missense Het probably damaging 0.998 phenotype 05/13/2019
25 547746 UTSW Mdc1 0.939 R7053 G1 225.01 N 17 35846326 A181V C T missense Het probably benign 0.003 phenotype 05/13/2019
26 547731 UTSW Mdga2 0.000 R7053 G1 225.01 N 12 66689384 I357F T A missense Het probably benign 0.405 phenotype 05/13/2019
27 547696 UTSW Mfn1 1.000 R7053 G1 225.01 N 3 32531965 I21V A G missense Het probably benign 0.002 phenotype 05/13/2019
28 547723 UTSW Mgat4b 0.000 R7053 G1 225.01 N 11 50233540 T409M C T missense Het probably damaging 1.000 phenotype 05/13/2019
29 547716 UTSW Mgat4d 0.000 R7053 G1 225.01 N 8 83371632 K341N G T missense Het probably damaging 0.976 05/13/2019
30 547726 UTSW Mpo 0.000 R7053 G1 225.01 N 11 87803510 N109Y A T missense Het probably damaging 0.994 phenotype 05/13/2019
31 547713 UTSW Mvp 0.000 R7053 G1 225.01 N 7 126987604 Q785R T C missense Het possibly damaging 0.899 phenotype 05/13/2019
32 547735 UTSW Nim1k 0.000 R7053 G1 225.01 N 13 119727609 V88A A G missense Het probably damaging 1.000 05/13/2019
33 547701 UTSW Oasl2 0.000 R7053 G1 225.01 N 5 114911230 I464L A T missense Het possibly damaging 0.819 05/13/2019
34 547695 UTSW Olfr1029 0.061 R7053 G1 225.01 N 2 85976014 C257F G T missense Het possibly damaging 0.641 phenotype 05/13/2019
35 547717 UTSW Pkd1l2 0.000 R7053 G1 225.01 N 8 117013942 F2139L A G missense Het probably damaging 1.000 phenotype 05/13/2019
36 547738 UTSW Pop1 0.952 R7053 G1 225.01 N 15 34530275 S940A T G missense Het probably benign 0.007 phenotype 05/13/2019
37 547705 UTSW Ppp1r9a 0.681 R7053 G1 225.01 N 6 4905670 M75K T A missense Het probably damaging 0.996 phenotype 05/13/2019
38 547742 UTSW Prdm15 0.000 R7053 G1 225.01 N 16 97794542 Q1029* G A nonsense Het probably null 05/13/2019
39 547724 UTSW Rffl 0.000 R7053 G1 225.01 N 11 82812671 K142R T C missense Het probably null 0.999 phenotype 05/13/2019
40 547718 UTSW Rhou 0.000 R7053 G1 225.01 N 8 123654195 A G intron Het probably benign phenotype 05/13/2019
41 547736 UTSW Rp1l1 0.074 R7053 G1 225.01 N 14 64031509 T1515S A T missense Het possibly damaging 0.675 phenotype 05/13/2019
42 547732 UTSW Serpina1b 0.178 R7053 G1 225.01 N 12 103732429 S54C T A missense Het possibly damaging 0.927 phenotype 05/13/2019
43 547699 UTSW Slc30a2 0.129 R7053 G1 225.01 N 4 134347415 R161Q G A missense Het probably damaging 1.000 phenotype 05/13/2019
44 547702 UTSW Taok3 0.000 R7053 G1 225.01 N 5 117252562 D529E T A missense Het probably benign 0.001 phenotype 05/13/2019
45 547729 UTSW Tmem18 0.112 R7053 G1 225.01 N 12 30584507 M1K T A start codon destroyed Het probably null 0.848 phenotype 05/13/2019
46 547698 UTSW Tmem269 0.156 R7053 G1 225.01 N 4 119209267 H198L T A missense Het probably damaging 0.980 05/13/2019
47 547704 UTSW Tnrc18 0.689 R7053 G1 225.01 N 5 142787229 V432A A G missense Het unknown 05/13/2019
48 547730 UTSW Ttc6 0.175 R7053 G1 225.01 N 12 57660532 T742S A T missense Het probably benign 0.015 05/13/2019
49 547747 UTSW Uhrf2 0.748 R7053 G1 225.01 N 19 30092119 C749S T A missense Het probably damaging 1.000 phenotype 05/13/2019
50 547719 UTSW Unc13c 0.000 R7053 G1 225.01 N 9 73932297 T424I G A missense Het probably damaging 1.000 phenotype 05/13/2019
51 547744 UTSW Vmn2r111 0.098 R7053 G1 225.01 N 17 22559051 N549S T C missense Het possibly damaging 0.502 0.179 05/13/2019
52 547709 UTSW Vmn2r61 0.092 R7053 G1 225.01 N 7 42267133 D390A A C missense Het probably damaging 0.958 05/13/2019
53 547721 UTSW Wisp3 0.000 R7053 G1 225.01 N 10 39158301 Y102H A G missense Het probably damaging 1.000 phenotype 05/13/2019
54 547737 UTSW Xpo7 0.269 R7053 G1 225.01 N 14 70684858 A G critical splice donor site 2 bp Het probably null phenotype 05/13/2019
55 547743 UTSW Zfp948 0.131 R7053 G1 225.01 N 17 21584859 L37* T A nonsense Het probably null 05/13/2019
[records 1 to 55 of 55]