Incidental Mutations

77 incidental mutations are currently displayed, and affect 76 genes.
13 are Possibly Damaging.
25 are Probably Damaging.
28 are Probably Benign.
7 are Probably Null.
2 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 77 of 77] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 547866 UTSW 1700113H08Rik 0.064 R7055 G1 225.01 N 10 87226221 S178P T C missense Het probably damaging 0.994 05/13/2019
2 547863 UTSW 2610008E11Rik 0.062 R7055 G1 225.01 N 10 79067847 E212K C T missense Het probably damaging 0.980 05/13/2019
3 547881 UTSW Abcc4 0.000 R7055 G1 225.01 N 14 118594785 L736* A T nonsense Het probably null phenotype 05/13/2019
4 547822 UTSW Acmsd 0.000 R7055 G1 225.01 N 1 127753833 M178L A T missense Het probably benign 0.100 phenotype 05/13/2019
5 547858 UTSW Adpgk 0.000 R7055 G1 225.01 N 9 59313193 M266K T A missense Het possibly damaging 0.755 phenotype 05/13/2019
6 547834 UTSW Aldh1b1 0.000 R7055 G1 225.01 N 4 45802909 R149H G A missense Het possibly damaging 0.842 phenotype 05/13/2019
7 547819 UTSW Aox2 0.066 R7055 G1 225.01 N 1 58299768 T307A A G missense Het probably benign 0.081 05/13/2019
8 547848 UTSW C1galt1 1.000 R7055 G1 225.01 N 6 7866585 Y144H T C missense Het probably damaging 1.000 phenotype 05/13/2019
9 547862 UTSW Cabin1 1.000 R7055 G1 225.01 N 10 75743283 Q440E G C missense Het probably benign 0.044 phenotype 05/13/2019
10 547831 UTSW Casq2 0.000 R7055 G1 225.01 N 3 102142245 S231G A G missense Het probably damaging 0.998 phenotype 05/13/2019
11 547827 UTSW Catsper2 0.116 R7055 G1 126.47 N 2 121397572 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT utr 3 prime Het probably benign phenotype 05/13/2019
12 547826 UTSW Cdan1 1.000 R7055 G1 225.01 N 2 120727861 I490T A G missense Het probably damaging 0.967 phenotype 05/13/2019
13 547877 UTSW Cep170b 0.563 R7055 G1 225.01 N 12 112735715 V314E T A missense Het probably damaging 1.000 05/13/2019
14 547821 UTSW Col4a4 0.100 R7055 G1 225.01 N 1 82519036 E413G T C missense Het unknown phenotype 05/13/2019
15 547847 UTSW Cyp3a25 0.085 R7055 G1 225.01 N 5 145992991 F189L A C missense Het probably benign 0.002 05/13/2019
16 547829 UTSW Dido1 0.959 R7055 G1 225.01 N 2 180661209 H1634L T A missense Het probably benign 0.094 phenotype 05/13/2019
17 547856 UTSW Dnaja2 0.676 R7055 G1 225.01 N 8 85548674 V156G A C missense Het probably benign 0.001 phenotype 05/13/2019
18 547832 UTSW Dpy19l4 0.089 R7055 G1 225.01 N 4 11290291 T C critical splice acceptor site Het probably null 05/13/2019
19 547860 UTSW Eomes 1.000 R7055 G1 225.01 N 9 118480499 N240I A T missense Het possibly damaging 0.568 phenotype 05/13/2019
20 547872 UTSW Fads6 0.088 R7055 G1 225.01 N 11 115285403 F199L A G missense Het probably benign 0.000 05/13/2019
21 547855 UTSW Fbrs 0.769 R7055 G1 225.01 N 7 127487784 T C critical splice donor site 2 bp Het probably null phenotype 05/13/2019
22 547843 UTSW Fndc4 0.000 R7055 G1 225.01 N 5 31294178 E153G T C missense Het probably benign 0.016 phenotype 05/13/2019
23 547840 UTSW Fv1 0.100 R7055 G1 217.47 N 4 147870318 TTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTC frame shift Het probably null phenotype 05/13/2019
24 547864 UTSW Fzr1 1.000 R7055 G1 225.01 N 10 81370223 Y210C T C missense Het probably damaging 1.000 phenotype 05/13/2019
25 547868 UTSW Gjc2 0.000 R7055 G1 225.01 N 11 59177030 M209L T A missense Het unknown phenotype 05/13/2019
26 547873 UTSW Gpr33 0.000 R7055 G1 225.01 N 12 52024253 M1T A G start codon destroyed Het probably null 0.989 phenotype 05/13/2019
27 547876 UTSW Gtf2a1 1.000 R7055 G1 225.01 N 12 91586749 I28N A T missense Het possibly damaging 0.932 phenotype 05/13/2019
28 547889 UTSW Igf2r 0.875 R7055 G1 225.01 N 17 12704323 Y1200D A C missense Het probably damaging 0.994 phenotype 05/13/2019
29 547825 UTSW Ivd 1.000 R7055 G1 225.01 N 2 118873249 T212I C T missense Het probably damaging 0.991 phenotype 05/13/2019
30 547828 UTSW Jag1 1.000 R7055 G1 225.01 N 2 137115489 V101A A G missense Het probably benign 0.259 phenotype 05/13/2019
31 547818 UTSW Kansl3 0.962 R7055 G1 225.01 N 1 36365620 V83D A T missense Het possibly damaging 0.855 05/13/2019
32 547884 UTSW Krt81 0.086 R7055 G1 225.01 N 15 101461125 I249F T A missense Het probably benign 0.431 phenotype 05/13/2019
33 547888 UTSW Krtap21-1 0.069 R7055 G1 225.01 N 16 89403703 S17L G A missense Het unknown 05/13/2019
34 547838 UTSW Macf1 1.000 R7055 G1 225.01 N 4 123409196 H504Q A T missense Het probably benign 0.013 phenotype 05/13/2019
35 547820 UTSW Map2 0.729 R7055 G1 225.01 N 1 66416824 T1499A A G missense Het probably damaging 0.998 phenotype 05/13/2019
36 547875 UTSW Map3k9 0.000 R7055 G1 225.01 N 12 81724208 T892A T C missense Het probably damaging 0.988 phenotype 05/13/2019
37 547830 UTSW Mcl1 R7055 G1 225.01 N 3 95659799 V178I G A missense Het probably benign 0.004 phenotype 05/13/2019
38 547878 UTSW Mrs2 0.000 R7055 G1 225.01 N 13 25004954 M126L T A missense Het probably benign 0.000 05/13/2019
39 547844 UTSW Msantd1 0.000 R7055 G1 225.01 N 5 34917661 N9K C A missense Het probably benign 0.000 05/13/2019
40 547883 UTSW Myh9 1.000 R7055 G1 218.01 N 15 77775198 R116H C T missense Het probably damaging 1.000 phenotype 05/13/2019
41 547837 UTSW Nfib 1.000 R7055 G1 225.01 N 4 82330425 D308E A T missense Het probably benign 0.026 phenotype 05/13/2019
42 547870 UTSW Nme2 0.000 R7055 G1 225.01 N 11 93955590 I11F T A missense Het probably damaging 0.976 phenotype 05/13/2019
43 547859 UTSW Nmnat3 0.094 R7055 G1 225.01 N 9 98410233 D111G A G missense Het probably benign 0.004 phenotype 05/13/2019
44 547824 UTSW Olfr1164 0.056 R7055 G1 225.01 N 2 88093701 L78F T A missense Het probably damaging 1.000 phenotype 05/13/2019
45 547893 UTSW Papss2 0.165 R7055 G1 225.01 N 19 32664427 W501R T C missense Het probably damaging 1.000 phenotype 05/13/2019
46 547885 UTSW Parn 0.955 R7055 G1 225.01 N 16 13626134 I384T A G missense Het possibly damaging 0.795 phenotype 05/13/2019
47 547892 UTSW Pcdhb18 0.161 R7055 G1 225.01 N 18 37490811 D398G A G missense Het possibly damaging 0.645 05/13/2019
48 547845 UTSW Pdcl2 0.111 R7055 G1 225.01 N 5 76317924 N102D T C missense Het probably benign 0.002 phenotype 05/13/2019
49 547849 UTSW Pdzrn3 0.846 R7055 G1 225.01 N 6 101151774 E644* C A nonsense Het probably null phenotype 05/13/2019
50 547886 UTSW Pi4ka 1.000 R7055 G1 225.01 N 16 17317015 T A utr 3 prime Het probably benign phenotype 05/13/2019
51 547871 UTSW Polg2 1.000 R7055 G1 225.01 N 11 106777214 F216L A G missense Het probably damaging 1.000 phenotype 05/13/2019
52 547857 UTSW Prkcsh 1.000 R7055 G1 217.01 N 9 22013161 *522W A G makesense Het probably null phenotype 05/13/2019
53 547841 UTSW Prkcz 0.000 R7055 G1 225.01 N 4 155289634 D108E G T missense Het probably benign 0.013 phenotype 05/13/2019
54 547887 UTSW Pros1 1.000 R7055 G1 225.01 N 16 62928102 V646A T C missense Het possibly damaging 0.845 phenotype 05/13/2019
55 547823 UTSW Ptprc 0.253 R7055 G1 225.01 N 1 138089571 I483T A G missense Het probably damaging 0.995 phenotype 05/13/2019
56 547854 UTSW Rabep2 0.765 R7055 G1 225.01 N 7 126445313 I527T T C missense Het possibly damaging 0.945 05/13/2019
57 547867 UTSW Rad50 1.000 R7055 G1 225.01 N 11 53688102 K543R T C missense Het probably benign 0.019 phenotype 05/13/2019
58 547852 UTSW Samd4b 0.686 R7055 G1 225.01 N 7 28404033 I553T A G missense Het probably benign 0.006 05/13/2019
59 547891 UTSW Sbpl 0.075 R7055 G1 225.01 N 17 23953302 N214K A T missense Het unknown 05/13/2019
60 547853 UTSW Scgb2b11 0.174 R7055 G1 225.01 N 7 32210482 E60K C T missense Het possibly damaging 0.831 05/13/2019
61 547817 UTSW Sgk3 0.224 R7055 G1 225.01 N 1 9886059 E331K G A missense Het probably damaging 1.000 phenotype 05/13/2019
62 547874 UTSW Snx6 0.828 R7055 G1 225.01 N 12 54784079 L32Q A T missense Het probably damaging 1.000 phenotype 05/13/2019
63 547850 UTSW Srgap3 0.406 R7055 G1 225.01 N 6 112746963 Q512L T A missense Het probably damaging 0.970 phenotype 05/13/2019
64 547833 UTSW Srsf12 0.099 R7055 G1 225.01 N 4 33226157 D135G A G missense Het probably damaging 0.998 05/13/2019
65 547842 UTSW Steap4 0.167 R7055 G1 225.01 N 5 7976858 T274A A G missense Het probably damaging 0.997 phenotype 05/13/2019
66 547835 UTSW Svep1 1.000 R7055 G1 225.01 N 4 58064275 V3236D A T missense Het probably benign 0.193 phenotype 05/13/2019
67 547836 UTSW Svep1 1.000 R7055 G1 225.01 N 4 58120642 F797Y A T missense Het probably benign 0.332 phenotype 05/13/2019
68 547846 UTSW Tmem116 0.000 R7055 G1 225.01 N 5 121467924 L113P T C missense Het probably damaging 1.000 05/13/2019
69 547839 UTSW Tnfrsf1b 0.344 R7055 G1 225.01 N 4 145224887 V161A A G missense Het probably damaging 0.996 phenotype 05/13/2019
70 547879 UTSW Tnpo1 0.968 R7055 G1 225.01 N 13 98855479 Q622K G T missense Het possibly damaging 0.851 phenotype 05/13/2019
71 547882 UTSW Top1mt 0.303 R7055 G1 225.01 N 15 75678674 V28A A G missense Het probably benign 0.010 phenotype 05/13/2019
72 547869 UTSW Trim25 0.000 R7055 G1 225.01 N 11 88999924 S146P T C missense Het probably benign 0.000 phenotype 05/13/2019
73 547851 UTSW Tuba3b 0.296 R7055 G1 225.01 N 6 145621209 D392G A G missense Het possibly damaging 0.539 05/13/2019
74 547861 UTSW Utrn 0.000 R7055 G1 225.01 N 10 12747921 R191Q C T missense Het probably benign 0.227 phenotype 05/13/2019
75 547890 UTSW Vmn2r111 0.123 R7055 G1 225.01 N 17 22559051 N549S T C missense Het possibly damaging 0.502 0.179 05/13/2019
76 547880 UTSW Wdfy2 0.319 R7055 G1 225.01 N 14 62900299 S84T T A missense Het probably benign 0.001 phenotype 05/13/2019
77 547865 UTSW Zfp873 0.074 R7055 G1 225.01 N 10 82059998 F225I T A missense Het probably damaging 1.000 05/13/2019
[records 1 to 77 of 77]