Incidental Mutations

79 incidental mutations are currently displayed, and affect 79 genes.
12 are Possibly Damaging.
31 are Probably Damaging.
19 are Probably Benign.
14 are Probably Null.
5 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 79 of 79] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 550030 UTSW 1700020L24Rik 0.551 R7088 G1 225.01 Y 11 83440406 E48* G T nonsense Het probably null 05/15/2019
2 550044 UTSW 2410089E03Rik 1.000 R7088 G1 225.01 Y 15 8218947 T1660M C T missense Het probably benign 0.161 phenotype 05/15/2019
3 549999 UTSW 5830473C10Rik 0.053 R7088 G1 225.01 Y 5 90572750 L260* T A nonsense Het probably null 05/15/2019
4 550031 UTSW Acaca 1.000 R7088 G1 225.01 Y 11 84278957 T C critical splice donor site 2 bp Het probably null phenotype 05/15/2019
5 549993 UTSW AI314180 0.439 R7088 G1 225.01 Y 4 58849766 L458I A T missense Het possibly damaging 0.927 05/15/2019
6 549987 UTSW Alkbh3 0.189 R7088 G1 225.01 Y 2 94004752 S83P A G missense Het possibly damaging 0.545 phenotype 05/15/2019
7 550050 UTSW Ammecr1l 0.126 R7088 G1 225.01 Y 18 31771819 S38P T C missense Het probably benign 0.000 05/15/2019
8 549998 UTSW Armc10 0.092 R7088 G1 225.01 Y 5 21653392 V145A T C missense Het probably damaging 0.959 phenotype 05/15/2019
9 550003 UTSW BC048671 0.049 R7088 G1 225.01 Y 6 90303240 K46R A G missense Het probably null 0.869 05/15/2019
10 550006 UTSW C2cd3 1.000 R7088 G1 225.01 Y 7 100416181 T347A A G missense Het phenotype 05/15/2019
11 549994 UTSW C8b 0.000 R7088 G1 225.01 Y 4 104793343 E449D G T missense Het probably benign 0.115 phenotype 05/15/2019
12 550051 UTSW Camk4 0.145 R7088 G1 225.01 Y 18 32939531 S46P T C missense Het probably benign 0.020 phenotype 05/15/2019
13 550012 UTSW Ccdc113 0.078 R7088 G1 225.01 Y 8 95538105 R81H G A missense Het probably benign 0.033 05/15/2019
14 550004 UTSW Cd177 0.486 R7088 G1 225.01 Y 7 24745133 C674* A T nonsense Het probably null phenotype 05/15/2019
15 550033 UTSW Cdc6 0.972 R7088 G1 225.01 Y 11 98919239 V458D T A missense Het probably damaging 0.998 phenotype 05/15/2019
16 550034 UTSW Cenpo 1.000 R7088 G1 225.01 Y 12 4215307 E238K C T missense Het probably benign 0.001 0.090 phenotype 05/15/2019
17 550009 UTSW Ckap2 0.375 R7088 G1 225.01 Y 8 22169866 P533Q G T missense Het possibly damaging 0.589 phenotype 05/15/2019
18 550042 UTSW Cma1 0.075 R7088 G1 225.01 Y 14 55943816 H44L T A missense Het probably damaging 1.000 phenotype 05/15/2019
19 550040 UTSW Cmya5 0.262 R7088 G1 225.01 Y 13 93091864 S2239T A T missense Het possibly damaging 0.954 05/15/2019
20 549979 UTSW Cntnap5b 0.125 R7088 G1 225.01 Y 1 100160077 I141N T A missense Het probably damaging 0.991 05/15/2019
21 550018 UTSW Col6a4 0.000 R7088 G1 225.01 Y 9 106000686 T2031S T A missense Het possibly damaging 0.557 05/15/2019
22 550015 UTSW Cxcr5 0.081 R7088 G1 225.01 Y 9 44513386 T325S T A missense Het possibly damaging 0.902 0.256 phenotype 05/15/2019
23 550007 UTSW Dhx32 0.092 R7088 G1 225.01 Y 7 133742688 L204Q A T missense Het probably damaging 1.000 0.647 phenotype 05/15/2019
24 550023 UTSW Dse 0.152 R7088 G1 225.01 Y 10 34153889 Y402H A G missense Het probably damaging 0.998 phenotype 05/15/2019
25 550053 UTSW Exoc6 0.000 R7088 G1 225.01 Y 19 37577010 C178F G T missense Het probably damaging 0.991 phenotype 05/15/2019
26 550011 UTSW Fam149a 0.000 R7088 G1 225.01 Y 8 45350545 V384A A G missense Het probably benign 0.076 05/15/2019
27 549990 UTSW Fcrl5 0.060 R7088 G1 225.01 Y 3 87457834 *597Q T C makesense Het probably null phenotype 05/15/2019
28 550045 UTSW Fer1l6 0.099 R7088 G1 225.01 Y 15 58564050 K431E A G missense Het possibly damaging 0.689 05/15/2019
29 549981 UTSW Fmo3 0.000 R7088 G1 225.01 Y 1 162968865 H46L T A missense Het probably benign 0.040 phenotype 05/15/2019
30 550038 UTSW Gcm2 0.455 R7088 G1 225.01 Y 13 41103364 D303G T C missense Het probably damaging 0.983 phenotype 05/15/2019
31 550000 UTSW Gk2 0.000 R7088 G1 225.01 Y 5 97455675 M435V T C missense Het probably damaging 0.971 05/15/2019
32 550027 UTSW Gli1 0.000 R7088 G1 225.01 Y 10 127335999 M295I C A missense Het probably damaging 0.997 phenotype 05/15/2019
33 550032 UTSW Gm11444 0.106 R7088 G1 225.01 Y 11 85847036 H109Q G T missense Het 05/15/2019
34 550047 UTSW Gtpbp1 0.000 R7088 G1 225.01 Y 15 79719282 D182E T A missense Het phenotype 05/15/2019
35 568482 UTSW Hnf4g 0.236 R7088 G1 225.01 Y 3 3648125 A T splice site 4 bp Het probably null phenotype 08/05/2019
36 550024 UTSW Hsf2 0.000 R7088 G1 225.01 Y 10 57512092 R483H G A missense Het probably damaging 1.000 0.348 phenotype 05/15/2019
37 549996 UTSW Kcnq4 0.503 R7088 G1 225.01 Y 4 120704399 R491H C T missense Het probably damaging 0.960 phenotype 05/15/2019
38 550049 UTSW Lama3 1.000 R7088 G1 225.01 Y 18 12582545 V1686A T C missense Het possibly damaging 0.904 phenotype 05/15/2019
39 550016 UTSW Larp6 0.000 R7088 G1 225.01 Y 9 60724355 K137E A G missense Het probably damaging 0.999 05/15/2019
40 550037 UTSW Mboat1 0.000 R7088 G1 225.01 Y 13 30195789 T G critical splice donor site 2 bp Het probably null phenotype 05/15/2019
41 550028 UTSW Mdh1 1.000 R7088 G1 225.01 Y 11 21558484 Y286C T C missense Het probably damaging 1.000 phenotype 05/15/2019
42 549989 UTSW Mga 0.917 R7088 G1 225.01 Y 2 119961936 K2607N G T missense Het probably damaging 1.000 phenotype 05/15/2019
43 550017 UTSW Morf4l1 1.000 R7088 G1 225.01 Y 9 90097380 V183F C A missense Het possibly damaging 0.591 phenotype 05/15/2019
44 550046 UTSW Mroh4 0.000 R7088 G1 225.01 Y 15 74626144 R196W G A missense Het probably benign 0.254 05/15/2019
45 550013 UTSW Muc16 0.127 R7088 G1 225.01 Y 9 18592680 M6438I C A missense Het probably damaging 0.993 0.297 phenotype 05/15/2019
46 549997 UTSW Myom3 0.242 R7088 G1 225.01 Y 4 135803278 Y1167C A G missense Het probably damaging 0.999 0.242 05/15/2019
47 549977 UTSW Neurl3 0.058 R7088 G1 225.01 Y 1 36269221 E170G T C missense Het possibly damaging 0.670 05/15/2019
48 550010 UTSW Nsd3 0.376 R7088 G1 225.01 Y 8 25666034 I539T T C missense Het probably benign 0.397 phenotype 05/15/2019
49 550043 UTSW Nup155 1.000 R7088 G1 225.01 Y 15 8156693 F1313S T C missense Het probably benign 0.114 phenotype 05/15/2019
50 550029 UTSW Nxn 1.000 R7088 G1 225.01 Y 11 76263148 V287E A T missense Het possibly damaging 0.937 0.919 phenotype 05/15/2019
51 549986 UTSW Olfr1253 0.060 R7088 G1 225.01 Y 2 89752099 T243I G A missense Het probably benign 0.009 phenotype 05/15/2019
52 550026 UTSW Olfr1354 0.233 R7088 G1 225.01 Y 10 78917759 L306F A C missense Het probably benign 0.002 0.090 phenotype 05/15/2019
53 550014 UTSW Olfr891 0.066 R7088 G1 225.01 Y 9 38180452 V124F C A missense Het probably damaging 1.000 0.647 phenotype 05/15/2019
54 549988 UTSW Pax6 1.000 R7088 G1 225.01 Y 2 105696408 N220D A G missense Het probably benign 0.003 phenotype 05/15/2019
55 550052 UTSW Pcdha11 0.167 R7088 G1 225.01 N 18 37005417 R33H G A missense Het probably benign 0.002 phenotype 05/15/2019
56 550054 UTSW Pdzd8 0.000 R7088 G1 225.01 Y 19 59344957 F211L A G missense Het probably damaging 0.999 0.086 05/15/2019
57 549991 UTSW Pear1 0.000 R7088 G1 225.01 Y 3 87754638 V477F C A missense Het possibly damaging 0.800 phenotype 05/15/2019
58 549982 UTSW Pex19 0.574 R7088 G1 217.47 N 1 172128583 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC frame shift Het probably null phenotype 05/15/2019
59 550008 UTSW Pidd1 0.000 R7088 G1 225.01 Y 7 141440487 V539E A T missense Het probably damaging 0.999 0.524 phenotype 05/15/2019
60 550041 UTSW Ptprg 0.000 R7088 G1 225.01 Y 14 12207365 I878F A T missense Het probably damaging 0.997 phenotype 05/15/2019
61 549984 UTSW Rabepk 0.085 R7088 G1 225.01 Y 2 34785699 T140A T C missense Het probably benign 0.006 05/15/2019
62 550025 UTSW Ranbp2 1.000 R7088 G1 225.01 Y 10 58463906 R454L G T missense Het probably damaging 0.999 0.190 phenotype 05/15/2019
63 550019 UTSW Rnf123 0.306 R7088 G1 225.01 Y 9 108058536 R943Q C T missense Het probably null 0.996 phenotype 05/15/2019
64 550020 UTSW Sash1 1.000 R7088 G1 225.01 Y 10 8729717 R970* G A nonsense Het probably null phenotype 05/15/2019
65 549980 UTSW Serpinb2 0.000 R7088 G1 225.01 Y 1 107524692 F333L C A missense Het probably damaging 0.999 phenotype 05/15/2019
66 568483 UTSW Shank3 0.298 R7088 G1 225.01 Y 15 89503525 T A splice site Het probably null phenotype 08/05/2019
67 549978 UTSW Slc9a2 0.058 R7088 G1 225.01 Y 1 40726379 I310L A C missense Het probably damaging 0.997 phenotype 05/15/2019
68 550001 UTSW Strip2 0.100 R7088 G1 225.01 Y 6 29920533 T A critical splice donor site 2 bp Het probably null 05/15/2019
69 550039 UTSW Thoc3 0.961 R7088 G1 225.01 Y 13 54463752 T241A T C missense Het probably damaging 0.999 phenotype 05/15/2019
70 550002 UTSW Tmem139 0.075 R7088 G1 225.01 Y 6 42263265 V2E T A missense Het probably damaging 0.979 05/15/2019
71 549995 UTSW Usp24 0.000 R7088 G1 225.01 Y 4 106387546 V1233F G T missense Het probably damaging 0.997 phenotype 05/15/2019
72 550022 UTSW Vnn1 0.084 R7088 G1 225.01 Y 10 23900747 Q332R A G missense Het probably benign 0.001 phenotype 05/15/2019
73 550048 UTSW Wac 1.000 R7088 G1 225.01 Y 18 7921455 H530Q T A missense Het probably damaging 0.991 phenotype 05/15/2019
74 550035 UTSW Wdr35 1.000 R7088 G1 225.01 Y 12 8978659 N92K T A missense Het probably benign 0.109 0.090 phenotype 05/15/2019
75 549983 UTSW Zbtb18 1.000 R7088 G1 225.01 Y 1 177447254 L60R T G missense Het probably damaging 1.000 phenotype 05/15/2019
76 550036 UTSW Zfp184 0.112 R7088 G1 225.01 Y 13 21959992 C623S T A missense Het probably damaging 1.000 phenotype 05/15/2019
77 549992 UTSW Zfp292 0.555 R7088 G1 225.01 Y 4 34806796 Y2088H A G missense Het probably damaging 1.000 05/15/2019
78 550005 UTSW Zfp975 0.066 R7088 G1 225.01 N 7 42662672 S172R G T missense Het probably benign 0.018 05/15/2019
79 549985 UTSW Zswim2 0.075 R7088 G1 225.01 Y 2 83915727 Q456* G A nonsense Het probably null 05/15/2019
[records 1 to 79 of 79]