Incidental Mutations

99 incidental mutations are currently displayed, and affect 97 genes.
19 are Possibly Damaging.
27 are Probably Damaging.
32 are Probably Benign.
16 are Probably Null.
4 create premature stop codons.
7 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 99 of 99] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 551839 UTSW 2900026A02Rik 0.077 R7117 G1 225.01 Y 5 113191384 Y254C T C missense Het probably benign 0.001 05/15/2019
2 551901 UTSW 4930480E11Rik 0.053 R7117 G1 222 Y X 78370705 M345I G T missense Het probably benign 0.237 05/15/2019
3 551835 UTSW 9330182L06Rik 0.000 R7117 G1 225.01 Y 5 9445384 C729* T A nonsense Het probably null 0.975 05/15/2019
4 551850 UTSW Adam12 0.294 R7117 G1 225.01 Y 7 133916462 I650V T C missense Het probably benign 0.001 phenotype 05/15/2019
5 551853 UTSW Adam39 0.069 R7117 G1 225.01 Y 8 40826242 G557C G T missense Het probably damaging 1.000 05/15/2019
6 551828 UTSW Ak5 0.116 R7117 G1 225.01 Y 3 152615856 A G critical splice donor site 2 bp Het probably null phenotype 05/15/2019
7 551833 UTSW Arhgef10l 0.105 R7117 G1 225.01 Y 4 140564186 C T critical splice donor site 1 bp Het probably null phenotype 05/15/2019
8 551893 UTSW Arhgef37 0.164 R7117 G1 225.01 Y 18 61504410 E394K C T missense Het probably benign 0.001 05/15/2019
9 551814 UTSW Baz2b 0.359 R7117 G1 225.01 Y 2 59912497 V13A A G missense Het phenotype 05/15/2019
10 551847 UTSW Bnc1 0.000 R7117 G1 225.01 Y 7 81973361 A706E G T missense Het possibly damaging 0.919 0.175 phenotype 05/15/2019
11 551897 UTSW Bscl2 0.000 R7117 G1 225.01 Y 19 8848514 A421T G A missense Het possibly damaging 0.675 0.070 phenotype 05/15/2019
12 551877 UTSW Btn1a1 0.000 R7117 G1 225.01 Y 13 23459245 W345G A C missense Het possibly damaging 0.913 phenotype 05/15/2019
13 551890 UTSW C3 0.000 R7117 G1 225.01 Y 17 57212655 M1199K A T missense Het probably benign 0.015 phenotype 05/15/2019
14 551831 UTSW C87499 0.303 R7117 G1 225.01 Y 4 88628958 M246L T A missense Het probably damaging 0.988 0.554 05/15/2019
15 551838 UTSW Ccdc18 0.000 R7117 G1 225.01 Y 5 108148969 L213V T G missense Het possibly damaging 0.952 05/15/2019
16 551824 UTSW Cers2 0.917 R7117 G1 225.01 Y 3 95320761 T C critical splice donor site 2 bp Het probably null phenotype 05/15/2019
17 551865 UTSW Chpt1 0.243 R7117 G1 225.01 Y 10 88480849 H249L T A missense Het probably damaging 0.985 05/15/2019
18 551863 UTSW Cited2 R7117 G1 225.01 N 10 17724616 E224G A G missense Het possibly damaging 0.941 phenotype 05/15/2019
19 551859 UTSW Cntn5 0.000 R7117 G1 225.01 Y 9 10904699 T A start gained Het probably benign phenotype 05/15/2019
20 551842 UTSW Col28a1 0.071 R7117 G1 225.01 Y 6 8013122 S977P A G missense Het possibly damaging 0.892 phenotype 05/15/2019
21 551864 UTSW Col6a1 0.219 R7117 G1 225.01 N 10 76725009 K52E T C missense Het probably damaging 1.000 phenotype 05/15/2019
22 551858 UTSW Cpne2 0.149 R7117 G1 225.01 Y 8 94555544 H239Q T A missense Het probably damaging 0.999 phenotype 05/15/2019
23 551813 UTSW Cr2 0.217 R7117 G1 225.01 Y 1 195160601 N244K A T missense Het possibly damaging 0.792 phenotype 05/15/2019
24 551886 UTSW Csf2rb2 0.000 R7117 G1 225.01 Y 15 78285185 D590G T C missense Het probably damaging 0.998 phenotype 05/15/2019
25 551821 UTSW Defb25 R7117 G1 225.01 Y 2 152622460 C55G A C missense Het probably damaging 0.994 05/15/2019
26 551810 UTSW Dnah7b 0.112 R7117 G1 225.01 Y 1 46352813 A T critical splice acceptor site Het probably null 0.976 05/15/2019
27 551888 UTSW Dvl3 1.000 R7117 G1 225.01 Y 16 20527322 Y467* T A nonsense Het probably null phenotype 05/15/2019
28 551826 UTSW Extl2 0.491 R7117 G1 225.01 Y 3 116027439 S312P T C missense Het probably damaging 1.000 phenotype 05/15/2019
29 551807 UTSW Fam178b 0.074 R7117 G1 225.01 Y 1 36600467 T313A T C missense Het probably benign 0.043 0.090 05/15/2019
30 551887 UTSW Fam186b 0.000 R7117 G1 225.01 Y 15 99285590 Y58H A G missense Het probably damaging 0.976 phenotype 05/15/2019
31 551855 UTSW Fat1 1.000 R7117 G1 225.01 Y 8 45031468 I3248L A T missense Het probably damaging 0.984 phenotype 05/15/2019
32 551868 UTSW Fat2 0.000 R7117 G1 225.01 Y 11 55281262 F2875S A G missense Het probably damaging 1.000 phenotype 05/15/2019
33 551879 UTSW Flnb 1.000 R7117 G1 225.01 Y 14 7894214 N760K T A missense Het probably benign 0.021 phenotype 05/15/2019
34 551891 UTSW Galnt14 0.107 R7117 G1 225.01 Y 17 73494195 H544R T C missense Het probably benign 0.002 phenotype 05/15/2019
35 551881 UTSW Gpr137c 0.071 R7117 G1 225.01 Y 14 45279027 R357S A C missense Het probably damaging 1.000 05/15/2019
36 551894 UTSW Grk2 1.000 R7117 G1 225.01 Y 19 4290602 A G critical splice donor site 2 bp Het probably null 0.960 phenotype 05/15/2019
37 551899 UTSW Hectd2 0.000 R7117 G1 225.01 Y 19 36599655 T342S A T missense Het probably benign 0.289 05/15/2019
38 551825 UTSW Hfe2 0.000 R7117 G1 225.01 Y 3 96528226 V267L G T missense Het possibly damaging 0.947 phenotype 05/15/2019
39 551812 UTSW Ildr2 0.389 R7117 G1 225.01 Y 1 166295811 G270C G T missense Het probably damaging 1.000 phenotype 05/15/2019
40 551873 UTSW Insm2 0.100 R7117 G1 225.01 Y 12 55600572 A367D C A missense Het probably damaging 1.000 05/15/2019
41 551874 UTSW Kcnh5 0.000 R7117 G1 225.01 Y 12 75114445 I230F T A missense Het possibly damaging 0.865 phenotype 05/15/2019
42 551898 UTSW Keg1 0.086 R7117 G1 225.01 Y 19 12709678 S24T T A missense Het probably damaging 1.000 05/15/2019
43 551866 UTSW Kera 0.000 R7117 G1 225.01 Y 10 97612852 E311D A T missense Het probably benign 0.000 phenotype 05/15/2019
44 551837 UTSW Kit 0.954 R7117 G1 225.01 Y 5 75607098 I47K T A missense Het probably benign 0.184 phenotype 05/15/2019
45 551834 UTSW Megf6 0.000 R7117 G1 225.01 Y 4 154258922 T663A A G missense Het possibly damaging 0.781 05/15/2019
46 551809 UTSW Mettl21c 0.000 R7117 G1 225.01 Y 1 44010648 A79V G A missense Het probably damaging 1.000 05/15/2019
47 568494 UTSW Mfsd1 0.000 R7117 G1 225.01 Y 3 67600058 T A splice site 6 bp Het probably null 08/09/2019
48 551829 UTSW Mob3b 0.085 R7117 G1 225.01 Y 4 34985914 A G critical splice donor site 2 bp Het probably null 0.949 phenotype 05/15/2019
49 551889 UTSW Morc2b 0.302 R7117 G1 225.01 Y 17 33137952 H282L T A missense Het probably benign 0.002 phenotype 05/15/2019
50 551892 UTSW Mtpap 1.000 R7117 G1 225.01 Y 18 4380889 T C critical splice donor site 2 bp Het probably null phenotype 05/15/2019
51 551854 UTSW Mtus1 0.179 R7117 G1 225.01 Y 8 41083584 V365A A G missense Het possibly damaging 0.954 phenotype 05/15/2019
52 551851 UTSW Muc5ac 0.000 R7117 G1 225.01 Y 7 141813822 Y2993* T A nonsense Het probably null phenotype 05/15/2019
53 551883 UTSW Mycbp2 1.000 R7117 G1 225.01 Y 14 103154077 F3422V A C missense Het probably benign 0.206 phenotype 05/15/2019
54 551856 UTSW Ndufb7 0.960 R7117 G1 225.01 Y 8 83570861 D48E T A missense Het probably benign 0.114 phenotype 05/15/2019
55 551840 UTSW Nxpe5 0.066 R7117 G1 225.01 Y 5 138239442 Y88C A G missense Het probably damaging 1.000 05/15/2019
56 551818 UTSW Olfr1177-ps 0.160 R7117 G1 85.01 Y 2 88344561 L64P A G missense Het probably damaging 1.000 05/15/2019
57 551848 UTSW Olfr575 0.072 R7117 G1 225.01 Y 7 102954978 M208L T A missense Het probably benign 0.000 0.090 phenotype 05/15/2019
58 551852 UTSW Osbpl5 0.000 R7117 G1 225.01 Y 7 143709783 D121V T A missense Het probably benign 0.014 phenotype 05/15/2019
59 551880 UTSW Oxnad1 0.062 R7117 G1 225.01 Y 14 32091651 H3L A T missense Het probably benign 0.003 05/15/2019
60 551811 UTSW Pam 1.000 R7117 G1 225.01 N 1 97977116 C A start gained Het probably benign phenotype 05/15/2019
61 551867 UTSW Papolg 0.941 R7117 G1 133.01 Y 11 23895207 T C start gained Het probably benign phenotype 05/15/2019
62 551820 UTSW Pax1 0.472 R7117 G1 225.01 Y 2 147366270 G266D G A missense Het probably damaging 0.981 phenotype 05/15/2019
63 551815 UTSW Pde11a 0.134 R7117 G1 225.01 Y 2 76076004 M623K A T missense Het probably damaging 1.000 phenotype 05/15/2019
64 551844 UTSW Peg3 0.000 R7117 G1 143.53 N 7 6709168 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC unclassified Het probably benign phenotype 05/15/2019
65 551819 UTSW Phf21a 1.000 R7117 G1 225.01 Y 2 92359157 Q587L A T missense Het probably benign 0.246 phenotype 05/15/2019
66 551895 UTSW Plcb3 0.618 R7117 G1 225.01 Y 19 6964378 L336P A G missense Het probably damaging 1.000 0.968 phenotype 05/15/2019
67 551882 UTSW Pnp2 0.103 R7117 G1 225.01 Y 14 50964474 *306Q T C makesense Het probably null 05/15/2019
68 551878 UTSW Pou5f2 0.193 R7117 G1 225.01 Y 13 78025273 I111M A G missense Het probably benign 0.088 phenotype 05/15/2019
69 551846 UTSW Prmt3 0.696 R7117 G1 225.01 Y 7 49818095 A350S G T missense Het probably benign 0.001 0.061 phenotype 05/15/2019
70 551872 UTSW Rac3 0.158 R7117 G1 225.01 Y 11 120723517 R163* A T nonsense Het probably null phenotype 05/15/2019
71 551822 UTSW Raly 0.000 R7117 G1 225.01 Y 2 154857512 V79L G T missense Het probably benign 0.347 phenotype 05/15/2019
72 551900 UTSW Rbm20 0.155 R7117 G1 225.01 Y 19 53851558 T993S A T missense Het possibly damaging 0.921 phenotype 05/15/2019
73 551827 UTSW Rwdd3 1.000 R7117 G1 225.01 Y 3 121171338 L56P A G missense Het probably benign 0.214 0.090 05/15/2019
74 551876 UTSW Serpina3a 0.054 R7117 G1 225.01 Y 12 104116177 H70Y C T missense Het possibly damaging 0.948 05/15/2019
75 551849 UTSW Sez6l2 0.000 R7117 G1 225.01 Y 7 126953743 E227A A C missense Het possibly damaging 0.945 phenotype 05/15/2019
76 551845 UTSW Shank1 0.281 R7117 G1 225.01 Y 7 44327161 A561V C T missense Het unknown 0.084 phenotype 05/15/2019
77 551861 UTSW Sidt2 0.163 R7117 G1 225.01 Y 9 45953219 V71I C T missense Het probably benign 0.006 0.061 phenotype 05/15/2019
78 551836 UTSW Slc35f6 0.000 R7117 G1 225.01 Y 5 30657707 L326P T C missense Het probably damaging 1.000 05/15/2019
79 551823 UTSW Sox2 1.000 R7117 G1 225.01 Y 3 34650926 G171S G A missense Het possibly damaging 0.946 phenotype 05/15/2019
80 551885 UTSW Spef2 0.099 R7117 G1 225.01 Y 15 9729838 R65C G A missense Het probably damaging 1.000 phenotype 05/15/2019
81 551896 UTSW Stip1 1.000 R7117 G1 225.01 Y 19 7021810 G467S C T missense Het possibly damaging 0.922 0.515 phenotype 05/15/2019
82 551870 UTSW Tada2a 0.854 R7117 G1 225.01 Y 11 84085688 I327F T A missense Het probably damaging 0.986 phenotype 05/15/2019
83 551871 UTSW Tex2 0.000 R7117 G1 225.01 Y 11 106544245 V785A A G missense Het unknown 05/15/2019
84 568497 UTSW Thada 0.000 R7117 G1 225.01 Y 17 84230786 C A splice site 5 bp Het probably null 0.976 phenotype 08/09/2019
85 568496 UTSW Theg 0.000 R7117 G1 164.01 Y 10 79584907 A T splice site Het probably null phenotype 08/09/2019
86 551860 UTSW Tmed1 0.133 R7117 G1 225.01 Y 9 21509254 T94M G A missense Het possibly damaging 0.486 phenotype 05/15/2019
87 551869 UTSW Tsr1 0.957 R7117 G1 225.01 Y 11 74899534 M149I G T missense Het probably benign 0.000 05/15/2019
88 551875 UTSW Ttc8 0.525 R7117 G1 225.01 Y 12 98976502 Y434H T C missense Het possibly damaging 0.634 phenotype 05/15/2019
89 551816 UTSW Ttn 1.000 R7117 G1 225.01 Y 2 76748175 Y24125H A G missense Het probably damaging 0.999 phenotype 05/15/2019
90 551817 UTSW Ttn 1.000 R7117 G1 225.01 Y 2 76942891 I2435T A G missense Het unknown phenotype 05/15/2019
91 568493 UTSW Ttn 1.000 R7117 G1 225.01 Y 2 76721909 G T splice site Het probably null phenotype 08/09/2019
92 551884 UTSW Uggt2 0.115 R7117 G1 225.01 Y 14 119014526 I1174M T C missense Het probably benign 0.251 0.090 phenotype 05/15/2019
93 551830 UTSW Unc13b 0.387 R7117 G1 225.01 Y 4 43216544 I281T T C missense Het probably benign 0.332 0.063 phenotype 05/15/2019
94 551832 UTSW Usp1 0.905 R7117 G1 225.01 Y 4 98928890 K106N G T missense Het possibly damaging 0.593 0.179 phenotype 05/15/2019
95 551808 UTSW Vwa3b 0.056 R7117 G1 225.01 Y 1 37135553 D15G A G missense Het 0.080 05/15/2019
96 551843 UTSW Zfp28 0.116 R7117 G1 225.01 Y 7 6394462 C632Y G A missense Het probably damaging 1.000 05/15/2019
97 551841 UTSW Zfp68 0.833 R7117 G1 225.01 Y 5 138606318 D581G T C missense Het probably benign 0.007 05/15/2019
98 551862 UTSW Zmynd10 0.579 R7117 G1 225.01 Y 9 107547517 S21R A C missense Het probably benign 0.216 phenotype 05/15/2019
99 551857 UTSW Zswim4 0.140 R7117 G1 225.01 Y 8 84214052 R806H C T missense Het probably damaging 1.000 05/15/2019
[records 1 to 99 of 99]