Incidental Mutations

69 incidental mutations are currently displayed, and affect 69 genes.
14 are Possibly Damaging.
16 are Probably Damaging.
27 are Probably Benign.
6 are Probably Null.
4 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 69 of 69] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 552493 UTSW 9930021J03Rik 0.107 R7128 G1 225.01 N 19 29716481 (GRCm38) T1871A T C missense Het possibly damaging 0.528 2019-05-15
2 552469 UTSW Adgb 0.000 R7128 G1 225.01 N 10 10472241 (GRCm38) D25G T C missense Het probably benign 0.262 2019-05-15
3 552471 UTSW Ak9 0.097 R7128 G1 225.01 N 10 41424717 (GRCm38) V1641A T C missense Het unknown phenotype 2019-05-15
4 552447 UTSW Akap2 0.166 R7128 G1 225.01 N 4 57855816 (GRCm38) S382P T C missense Het probably benign 0.028 phenotype 2019-05-15
5 552445 UTSW Akirin2 1.000 R7128 G1 225.01 N 4 34562435 (GRCm38) I118T T C missense Het probably benign 0.006 phenotype 2019-05-15
6 552454 UTSW Aldh1l1 0.000 R7128 G1 225.01 N 6 90563379 (GRCm38) Q215H G T missense Het probably benign 0.232 phenotype 2019-05-15
7 552441 UTSW Arhgef26 0.173 R7128 G1 225.01 N 3 62419550 (GRCm38) F495L T C missense Het possibly damaging 0.940 phenotype 2019-05-15
8 552443 UTSW Atg4a-ps 0.135 R7128 G1 225.01 N 3 103645747 (GRCm38) R93* T A nonsense Het probably null 2019-05-15
9 552472 UTSW AW822073 0.076 R7128 G1 147.01 N 10 58223657 (GRCm38) Q425R T C missense Het unknown 2019-05-15
10 552482 UTSW Catsper3 0.000 R7128 G1 225.01 N 13 55798849 (GRCm38) I120V A G missense Het probably benign 0.004 phenotype 2019-05-15
11 552428 UTSW Cavin2 0.235 R7128 G1 225.01 N 1 51289420 (GRCm38) Q12R A G missense Het possibly damaging 0.571 phenotype 2019-05-15
12 552434 UTSW Cenpf 0.596 R7128 G1 225.01 N 1 189684991 (GRCm38) F39Y A T missense Het probably damaging 0.999 phenotype 2019-05-15
13 552450 UTSW Chfr 0.197 R7128 G1 225.01 N 5 110143636 (GRCm38) Y107H T C missense Het probably benign 0.329 phenotype 2019-05-15
14 552464 UTSW Cmtm1 0.278 R7128 G1 151.46 N 8 104309470 (GRCm38) CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT small deletion Het probably benign 0.090 2019-05-15
15 552461 UTSW Defb4 0.053 R7128 G1 225.01 N 8 19201204 (GRCm38) I29K T A missense Het possibly damaging 0.589 2019-05-15
16 552427 UTSW Dnah7c 0.343 R7128 G1 225.01 N 1 46527485 (GRCm38) T619A A G missense Het probably benign 0.000 2019-05-15
17 552455 UTSW Emc3 1.000 R7128 G1 225.01 N 6 113517920 (GRCm38) L179P A G missense Het probably damaging 1.000 2019-05-15
18 552478 UTSW Eno3 0.821 R7128 G1 225.01 N 11 70658604 (GRCm38) V84L G C missense Het possibly damaging 0.764 phenotype 2019-05-15
19 552438 UTSW Fam110a 0.218 R7128 G1 225.01 N 2 151970722 (GRCm38) V43M C T missense Het probably damaging 1.000 2019-05-15
20 552449 UTSW Fam159a 0.095 R7128 G1 225.01 N 4 108367903 (GRCm38) T154K G T missense Het probably benign 0.000 2019-05-15
21 552470 UTSW Fbxo30 0.201 R7128 G1 225.01 N 10 11290116 (GRCm38) L194* T A nonsense Het probably null phenotype 2019-05-15
22 552490 UTSW Galnt14 0.079 R7128 G1 225.01 N 17 73545101 (GRCm38) T108A T C missense Het probably benign 0.000 phenotype 2019-05-15
23 552446 UTSW Glipr2 0.195 R7128 G1 225.01 N 4 43968601 (GRCm38) I51T T C missense Het probably benign 0.099 2019-05-15
24 552439 UTSW Gm1527 0.052 R7128 G1 225.01 N 3 28915311 (GRCm38) S270F C T missense Het possibly damaging 0.951 2019-05-15
25 552462 UTSW Gm3336 0.059 R7128 G1 192.01 N 8 70718554 (GRCm38) M1V A G start codon destroyed Het probably null 2019-05-15
26 552452 UTSW Gm4744 0.070 R7128 G1 225.01 N 6 40950376 (GRCm38) D15G T C missense Het 2019-05-15
27 552458 UTSW Gm4763 0.057 R7128 G1 210.01 N 7 24725999 (GRCm38) C T critical splice donor site 1 bp Het probably null 2019-05-15
28 552473 UTSW Gm4924 0.109 R7128 G1 225.01 N 10 82378699 (GRCm38) C777Y G A missense Het unknown 2019-05-15
29 552460 UTSW Gm5901 0.082 R7128 G1 225.01 N 7 105378201 (GRCm38) G306S G A missense Het probably damaging 0.983 2019-05-15
30 552442 UTSW Gon4l 0.748 R7128 G1 225.01 N 3 88895692 (GRCm38) N1203K T A missense Het possibly damaging 0.938 phenotype 2019-05-15
31 552432 UTSW Gpr161 1.000 R7128 G1 225.01 N 1 165310457 (GRCm38) Y204F A T missense Het possibly damaging 0.915 phenotype 2019-05-15
32 552440 UTSW Igsf10 0.212 R7128 G1 225.01 N 3 59328905 (GRCm38) E1285G T C missense Het probably benign 0.000 2019-05-15
33 552463 UTSW Irx6 0.087 R7128 G1 225.01 N 8 92677366 (GRCm38) L187P T C missense Het probably damaging 1.000 phenotype 2019-05-15
34 552481 UTSW Itgb1bp1 1.000 R7128 G1 225.01 N 12 21272088 (GRCm38) Y117H A G missense Het probably benign 0.070 phenotype 2019-05-15
35 552433 UTSW Itln1 0.000 R7128 G1 225.01 N 1 171530575 (GRCm38) D202Y C A missense Het possibly damaging 0.918 phenotype 2019-05-15
36 552483 UTSW Kctd9 0.000 R7128 G1 225.01 N 14 67738523 (GRCm38) S242P T C missense Het probably benign 0.019 2019-05-15
37 552487 UTSW Lrrk2 0.335 R7128 G1 225.01 N 15 91801885 (GRCm38) H2143R A G missense Het probably benign 0.000 phenotype 2019-05-15
38 552485 UTSW Lynx1 0.000 R7128 G1 225.01 N 15 74751549 (GRCm38) R50* G A nonsense Het probably null phenotype 2019-05-15
39 552466 UTSW Map10 0.067 R7128 G1 225.01 N 8 125671853 (GRCm38) I662V A G missense Het probably benign 0.000 2019-05-15
40 552451 UTSW Mlxipl 0.477 R7128 G1 225.01 N 5 135133851 (GRCm38) L691P T C missense Het probably damaging 0.979 phenotype 2019-05-15
41 552467 UTSW Muc16 0.114 R7128 G1 225.01 N 9 18643004 (GRCm38) S3998P A G missense Het unknown phenotype 2019-05-15
42 552484 UTSW Nalcn 1.000 R7128 G1 225.01 N 14 123594502 (GRCm38) V120E A T missense Het probably damaging 0.994 phenotype 2019-05-15
43 552465 UTSW Nfat5 0.914 R7128 G1 225.01 N 8 107358691 (GRCm38) S539P T C missense Het probably benign 0.105 phenotype 2019-05-15
44 552444 UTSW Olfml3 0.000 R7128 G1 225.01 N 3 103737168 (GRCm38) M62V T C missense Het probably benign 0.000 phenotype 2019-05-15
45 552448 UTSW Orm3 0.048 R7128 G1 225.01 N 4 63357825 (GRCm38) V158A T C missense Het probably benign 0.246 2019-05-15
46 552488 UTSW Pced1b 0.240 R7128 G1 225.01 N 15 97384598 (GRCm38) K173* A T nonsense Het probably null phenotype 2019-05-15
47 552495 UTSW Pdzd7 0.298 R7128 G1 225.01 N 19 45027949 (GRCm38) D911G T C missense Het probably damaging 0.993 phenotype 2019-05-15
48 552435 UTSW Pkn3 0.000 R7128 G1 225.01 N 2 30083315 (GRCm38) D383G A G missense Het probably damaging 1.000 phenotype 2019-05-15
49 552431 UTSW Pm20d1 0.071 R7128 G1 225.01 N 1 131797554 (GRCm38) E46G A G missense Het probably benign 0.012 2019-05-15
50 552494 UTSW Pyroxd2 0.106 R7128 G1 225.01 N 19 42731403 (GRCm38) S455T A T missense Het probably benign 0.450 2019-05-15
51 552476 UTSW Rmnd5b 0.000 R7128 G1 225.01 N 11 51624537 (GRCm38) I301F T A missense Het possibly damaging 0.910 2019-05-15
52 552457 UTSW Rnf225 0.000 R7128 G1 225.01 N 7 12927984 (GRCm38) N30S A G missense Het probably benign 0.026 2019-05-15
53 552479 UTSW Slfn3 0.000 R7128 G1 225.01 N 11 83214895 (GRCm38) C573S T A missense Het probably benign 0.002 phenotype 2019-05-15
54 552480 UTSW Smc6 1.000 R7128 G1 225.01 N 12 11301631 (GRCm38) E887G A G missense Het probably damaging 1.000 phenotype 2019-05-15
55 552430 UTSW Sp140 0.087 R7128 G1 225.01 N 1 85620125 (GRCm38) D191V A T missense Het possibly damaging 0.630 phenotype 2019-05-15
56 552489 UTSW Srf 1.000 R7128 G1 225.01 N 17 46555446 (GRCm38) S128N C T missense Het possibly damaging 0.883 phenotype 2019-05-15
57 552491 UTSW Sult6b1 0.081 R7128 G1 225.01 N 17 78894641 (GRCm38) D144G T C missense Het probably damaging 0.998 2019-05-15
58 552468 UTSW Syne1 1.000 R7128 G1 225.01 N 10 5243180 (GRCm38) A3956V G A missense Het probably damaging 1.000 phenotype 2019-05-15
59 552486 UTSW Syt10 0.092 R7128 G1 225.01 N 15 89814111 (GRCm38) D343E A T missense Het probably damaging 0.995 phenotype 2019-05-15
60 552475 UTSW Tgtp2 0.000 R7128 G1 225.01 N 11 49059308 (GRCm38) R146C G A missense Het possibly damaging 0.772 2019-05-15
61 552474 UTSW Tmcc3 0.000 R7128 G1 225.01 N 10 94430634 (GRCm38) A T start gained Het probably benign 2019-05-15
62 552456 UTSW Tnfrsf1a 0.000 R7128 G1 225.01 N 6 125361536 (GRCm38) T337S A T missense Het probably benign 0.107 phenotype 2019-05-15
63 552429 UTSW Tns1 0.583 R7128 G1 225.01 N 1 73995304 (GRCm38) I144N A T missense Het phenotype 2019-05-15
64 552477 UTSW Trim11 0.261 R7128 G1 225.01 N 11 58978277 (GRCm38) E13G A G missense Het probably damaging 1.000 phenotype 2019-05-15
65 552492 UTSW Trpm6 1.000 R7128 G1 225.01 N 19 18811773 (GRCm38) H569L A T missense Het possibly damaging 0.920 phenotype 2019-05-15
66 552437 UTSW Ttbk2 1.000 R7128 G1 225.01 N 2 120746088 (GRCm38) I803L T A missense Het probably benign 0.001 phenotype 2019-05-15
67 552453 UTSW Vmn1r21 0.229 R7128 G1 225.01 N 6 57843951 (GRCm38) N169K G T missense Het probably damaging 0.968 2019-05-15
68 552459 UTSW Vmn2r60 0.084 R7128 G1 225.01 N 7 42195112 (GRCm38) T633I C T missense Het probably damaging 0.959 2019-05-15
69 552436 UTSW Wt1 1.000 R7128 G1 225.01 N 2 105127325 (GRCm38) Y177H T C missense Het probably benign 0.035 phenotype 2019-05-15
[records 1 to 69 of 69]