Incidental Mutations

59 incidental mutations are currently displayed, and affect 59 genes.
7 are Possibly Damaging.
27 are Probably Damaging.
14 are Probably Benign.
9 are Probably Null.
3 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 59 of 59] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 552524 UTSW 1700030K09Rik 0.054 R7129 G1 225.01 Y 8 72455355 E443G A G missense Het probably damaging 1.000 05/15/2019
2 568455 UTSW 2700049A03Rik 1.000 R7129 G1 225.01 Y 12 71216230 A G intron 34 bp Het probably null 0.976 phenotype 07/31/2019
3 552513 UTSW 3110082I17Rik 0.000 R7129 G1 225.01 Y 5 139363983 Y104H A G missense Het probably damaging 1.000 0.705 05/15/2019
4 552527 UTSW Abcg4 0.182 R7129 G1 225.01 Y 9 44279384 K282E T C missense Het probably benign 0.032 phenotype 05/15/2019
5 552520 UTSW Adamts17 0.068 R7129 G1 225.01 Y 7 67121010 S956P T C missense Het probably damaging 1.000 phenotype 05/15/2019
6 552503 UTSW Adh1 0.000 R7129 G1 225.01 Y 3 138280474 V74A T C missense Het probably damaging 0.983 0.153 phenotype 05/15/2019
7 552539 UTSW Akt1 0.932 R7129 G1 225.01 Y 12 112659649 M63K A T missense Het probably benign 0.225 phenotype 05/15/2019
8 552500 UTSW Arfrp1 1.000 R7129 G1 225.01 Y 2 181359551 R177* G A nonsense Het probably null phenotype 05/15/2019
9 552540 UTSW Arl11 0.069 R7129 G1 225.01 Y 14 61310897 E52G A G missense Het possibly damaging 0.673 phenotype 05/15/2019
10 552523 UTSW BC051019 0.108 R7129 G1 225.01 Y 7 109720618 S10G T C missense Het 0.087 05/15/2019
11 552530 UTSW Bfsp2 0.130 R7129 G1 225.01 Y 9 103479919 E103V T A missense Het probably damaging 0.991 phenotype 05/15/2019
12 552518 UTSW Bms1 1.000 R7129 G1 225.01 Y 6 118403161 C728* G T nonsense Het probably null 0.976 phenotype 05/15/2019
13 552505 UTSW Cachd1 0.231 R7129 G1 225.01 Y 4 100918066 N159K T G missense Het probably null 0.987 05/15/2019
14 552511 UTSW Cd38 0.000 R7129 G1 225.01 Y 5 43910309 N294S A G missense Het probably benign 0.131 0.069 phenotype 05/15/2019
15 552532 UTSW Cfap54 0.108 R7129 G1 225.01 Y 10 93016571 N891S T C missense Het probably benign 0.065 phenotype 05/15/2019
16 552550 UTSW Chsy3 0.000 R7129 G1 225.01 Y 18 59410298 H836L A T missense Het probably damaging 1.000 phenotype 05/15/2019
17 552544 UTSW Cldn16 0.000 R7129 G1 225.01 Y 16 26482638 D232V A T missense Het probably damaging 0.998 phenotype 05/15/2019
18 552536 UTSW Dhx33 1.000 R7129 G1 225.01 Y 11 70993863 I425N A T missense Het probably damaging 1.000 phenotype 05/15/2019
19 552538 UTSW Dock4 0.227 R7129 G1 225.01 Y 12 40828879 N1506D A G missense Het probably damaging 1.000 0.162 phenotype 05/15/2019
20 552509 UTSW Dok7 1.000 R7129 G1 225.01 Y 5 35079048 S227P T C missense Het probably damaging 0.999 0.099 phenotype 05/15/2019
21 552501 UTSW Elf2 0.292 R7129 G1 225.01 Y 3 51261011 R201G T C missense Het probably damaging 0.958 05/15/2019
22 552534 UTSW Etaa1 0.000 R7129 G1 225.01 Y 11 17940339 R841G T C missense Het possibly damaging 0.920 05/15/2019
23 552514 UTSW Exoc4 1.000 R7129 G1 225.01 Y 6 33971999 Y926H T C missense Het probably damaging 1.000 phenotype 05/15/2019
24 552512 UTSW Fras1 0.000 R7129 G1 225.01 Y 5 96781284 H3849R A G missense Het probably benign 0.001 phenotype 05/15/2019
25 552521 UTSW Hapln3 0.075 R7129 G1 225.01 Y 7 79121824 G106R C T missense Het probably damaging 1.000 phenotype 05/15/2019
26 568454 UTSW Hmcn1 0.000 R7129 G1 225.01 Y 1 150577210 A C intron 62 bp Het probably null phenotype 07/31/2019
27 552543 UTSW Ifitm7 R7129 G1 225.01 Y 16 13983736 I53N A T missense Het possibly damaging 0.921 05/15/2019
28 552504 UTSW Ikbkap 1.000 R7129 G1 225.01 Y 4 56787944 H329R T C missense Het probably damaging 1.000 phenotype 05/15/2019
29 552502 UTSW Il6ra 0.000 R7129 G1 225.01 Y 3 89871247 N433D T C missense Het probably damaging 0.993 0.100 phenotype 05/15/2019
30 552528 UTSW Iqch 0.066 R7129 G1 225.01 Y 9 63421909 V1048I C T missense Het probably benign 0.092 05/15/2019
31 552548 UTSW Kif20a 1.000 R7129 G1 225.01 Y 18 34632535 T862A A G missense Het probably benign 0.004 0.057 05/15/2019
32 552542 UTSW Mcrs1 1.000 R7129 G1 225.01 Y 15 99248728 L141F G A missense Het probably damaging 0.998 0.437 phenotype 05/15/2019
33 552510 UTSW Nkx3-2 1.000 R7129 G1 225.01 Y 5 41761674 S324P A G missense Het probably damaging 0.998 0.301 phenotype 05/15/2019
34 552497 UTSW Nmi 0.097 R7129 G1 225.01 Y 2 51955924 A T critical splice donor site 2 bp Het probably null 0.959 phenotype 05/15/2019
35 552541 UTSW Nufip1 1.000 R7129 G1 225.01 Y 14 76134885 K480E A G missense Het possibly damaging 0.825 0.106 phenotype 05/15/2019
36 552531 UTSW Oit3 0.279 R7129 G1 225.01 Y 10 59428344 I323F T A missense Het probably damaging 0.990 phenotype 05/15/2019
37 552552 UTSW Olfr1450 0.059 R7129 G1 225.01 Y 19 12954114 H175L A T missense Het possibly damaging 0.935 phenotype 05/15/2019
38 552522 UTSW Olfr699 0.087 R7129 G1 225.01 Y 7 106790483 K173E T C missense Het probably benign 0.001 0.090 phenotype 05/15/2019
39 552549 UTSW Pcdha11 0.144 R7129 G1 225.01 Y 18 37007238 E640G A G missense Het probably benign 0.452 0.090 phenotype 05/15/2019
40 552529 UTSW Phip 1.000 R7129 G1 225.01 Y 9 82877300 V1366I C T missense Het probably damaging 0.984 phenotype 05/15/2019
41 552547 UTSW Plin5 0.162 R7129 G1 225.01 Y 17 56115174 M162V T C missense Het probably null 0.000 0.976 phenotype 05/15/2019
42 552517 UTSW Podxl2 0.000 R7129 G1 225.01 Y 6 88843505 A G critical splice donor site 2 bp Het probably null 0.959 phenotype 05/15/2019
43 552533 UTSW Ptprb 1.000 R7129 G1 195.46 N 10 116283677 GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT small deletion Het probably benign phenotype 05/15/2019
44 552525 UTSW Rab4a 0.000 R7129 G1 225.01 Y 8 123827330 D40V A T missense Het probably benign 0.029 0.071 phenotype 05/15/2019
45 552498 UTSW Scn7a 0.124 R7129 G1 225.01 Y 2 66700193 F603L A G missense Het probably benign 0.145 phenotype 05/15/2019
46 552537 UTSW Slfn5 0.090 R7129 G1 225.01 Y 11 82961150 K701* A T nonsense Het probably null 05/15/2019
47 552508 UTSW Speer4f2 0.107 R7129 G1 225.01 N 5 17377448 D223G A G missense Het 05/15/2019
48 552551 UTSW Stip1 1.000 R7129 G1 225.01 Y 19 7021810 G467S C T missense Het possibly damaging 0.922 0.515 phenotype 05/15/2019
49 552519 UTSW Tas2r117 0.054 R7129 G1 225.01 Y 6 132803387 T163S A T missense Het probably benign 0.009 05/15/2019
50 552526 UTSW Tecta 0.105 R7129 G1 225.01 Y 9 42347991 D1532G T C missense Het probably damaging 1.000 phenotype 05/15/2019
51 552496 UTSW Tmem63a 0.116 R7129 G1 225.01 Y 1 180954876 I146T T C missense Het probably damaging 0.980 05/15/2019
52 552499 UTSW Ttn 1.000 R7129 G1 225.01 Y 2 76816171 G12844W C A missense Het probably damaging 0.994 phenotype 05/15/2019
53 552535 UTSW Usp22 1.000 R7129 G1 225.01 Y 11 61162949 I190V T C missense Het probably damaging 0.976 phenotype 05/15/2019
54 552506 UTSW Usp24 0.000 R7129 G1 225.01 Y 4 106362215 I536T T C missense Het probably damaging 0.995 phenotype 05/15/2019
55 552516 UTSW Vmn1r23 0.093 R7129 G1 225.01 Y 6 57926076 V239A A G missense Het possibly damaging 0.886 05/15/2019
56 552515 UTSW Vmn1r9 0.087 R7129 G1 225.01 Y 6 57071626 T229P A C missense Het probably damaging 0.996 05/15/2019
57 552545 UTSW Zbtb21 0.584 R7129 G1 116.47 Y 16 97951687 AGCTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGC small deletion Het probably benign 05/15/2019
58 552507 UTSW Zbtb8a 0.249 R7129 G1 225.01 Y 4 129360395 A102G G C missense Het probably damaging 1.000 05/15/2019
59 552546 UTSW Zfp51 0.423 R7129 G1 225.01 Y 17 21461709 W57R T C missense Het probably damaging 1.000 05/15/2019
[records 1 to 59 of 59]