Incidental Mutations

72 incidental mutations are currently displayed, and affect 71 genes.
12 are Possibly Damaging.
17 are Probably Damaging.
26 are Probably Benign.
11 are Probably Null.
7 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 72 of 72] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 552757 UTSW Ank3 0.850 R7132 G1 225.01 N 10 69989914 A1471V C T missense Het phenotype 05/15/2019
2 552779 UTSW Ankrd12 0.299 R7132 G1 225.01 N 17 65983247 M1730I C A missense Het probably benign 0.000 phenotype 05/15/2019
3 552751 UTSW Ap2a2 0.335 R7132 G1 225.01 N 7 141619565 Y462H T C missense Het probably benign 0.318 phenotype 05/15/2019
4 552784 UTSW Ap5b1 0.146 R7132 G1 225.01 N 19 5569384 Y277* T A nonsense Het probably null 05/15/2019
5 552774 UTSW App 0.623 R7132 G1 225.01 N 16 85056482 D236G T C missense Het unknown phenotype 05/15/2019
6 552771 UTSW Arid2 1.000 R7132 G1 225.01 N 15 96350013 K102I A T missense Het possibly damaging 0.673 phenotype 05/15/2019
7 552739 UTSW Asl 0.283 R7132 G1 225.01 N 5 130014702 V211A A G missense Het possibly damaging 0.574 phenotype 05/15/2019
8 552770 UTSW Card6 0.000 R7132 G1 214.46 N 15 5098691 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG small deletion Het probably benign phenotype 05/15/2019
9 552765 UTSW Cbx2 1.000 R7132 G1 128.01 N 11 119023121 S5G A G missense Het probably benign 0.076 phenotype 05/15/2019
10 552723 UTSW Ccdc183 0.092 R7132 G1 225.01 N 2 25616530 A G critical splice donor site 2 bp Het probably null 05/15/2019
11 552736 UTSW Cd72 0.265 R7132 G1 225.01 N 4 43452444 Q183R T C missense Het possibly damaging 0.816 phenotype 05/15/2019
12 552732 UTSW Cdh26 0.000 R7132 G1 225.01 N 2 178486762 D702E T A missense Het possibly damaging 0.565 phenotype 05/15/2019
13 552730 UTSW Cfap61 0.000 R7132 G1 225.01 N 2 146109950 N784I A T missense Het probably damaging 0.966 05/15/2019
14 552769 UTSW Cgrrf1 0.000 R7132 G1 225.01 N 14 46853864 V282M G A missense Het probably damaging 0.998 05/15/2019
15 552752 UTSW Cmtm1 0.165 R7132 G1 147.46 N 8 104309470 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT small deletion Het probably benign 0.090 05/15/2019
16 552724 UTSW Cobll1 0.286 R7132 G1 225.01 N 2 65133768 K170Q T G missense Het probably damaging 1.000 05/15/2019
17 552743 UTSW Copg2 0.908 R7132 G1 225.01 N 6 30815996 V468D A T missense Het probably benign 0.001 05/15/2019
18 552750 UTSW Cracr2b 0.077 R7132 G1 225.01 N 7 141463738 A84V C T missense Het probably benign 0.296 05/15/2019
19 552747 UTSW Cyp2f2 0.129 R7132 G1 225.01 N 7 27132568 D416V A T missense Het probably benign 0.002 phenotype 05/15/2019
20 552737 UTSW Dcaf10 0.000 R7132 G1 176.01 N 4 45342391 F75S T C missense Het probably benign 0.000 05/15/2019
21 552786 UTSW Eml3 0.774 R7132 G1 225.01 N 19 8941028 A829S G T missense Het probably benign 0.252 05/15/2019
22 552755 UTSW Entpd3 0.111 R7132 G1 225.01 N 9 120561020 T402A A G missense Het probably benign 0.001 phenotype 05/15/2019
23 552731 UTSW Fer1l4 0.000 R7132 G1 225.01 N 2 156045626 V550E A T missense Het probably damaging 0.980 05/15/2019
24 552733 UTSW Fgb 0.836 R7132 G1 225.01 N 3 83046746 R62* G A nonsense Het probably null phenotype 05/15/2019
25 552734 UTSW Fubp1 1.000 R7132 G1 225.01 N 3 152232024 T A critical splice donor site 2 bp Het probably null phenotype 05/15/2019
26 552744 UTSW Gdf3 1.000 R7132 G1 225.01 N 6 122606324 D361E A C missense Het probably damaging 1.000 phenotype 05/15/2019
27 552758 UTSW Gm6685 R7132 G1 225.01 N 11 28339330 I162N A T missense Het probably damaging 1.000 05/15/2019
28 552749 UTSW Hmx2 0.000 R7132 G1 225.01 N 7 131555916 Y253C A G missense Het probably damaging 0.994 phenotype 05/15/2019
29 552763 UTSW Ints2 1.000 R7132 G1 225.01 N 11 86217754 N922K G T missense Het probably benign 0.264 phenotype 05/15/2019
30 552748 UTSW Ipo7 0.958 R7132 G1 225.01 N 7 110054047 L984F C T missense Het probably benign 0.173 phenotype 05/15/2019
31 552762 UTSW Itgae 0.000 R7132 G1 225.01 N 11 73111358 Y96F A T missense Het possibly damaging 0.933 phenotype 05/15/2019
32 552773 UTSW Kalrn 0.915 R7132 G1 225.01 N 16 34256227 V697A A G missense Het unknown phenotype 05/15/2019
33 552718 UTSW Kctd18 0.083 R7132 G1 225.01 N 1 57967578 R38* G A nonsense Het probably null 05/15/2019
34 552721 UTSW Kdm5b 0.323 R7132 G1 225.01 N 1 134599106 D322G A G missense Het probably damaging 1.000 phenotype 05/15/2019
35 552768 UTSW Ldb3 1.000 R7132 G1 225.01 N 14 34577035 Y211H A G missense Het probably benign 0.246 phenotype 05/15/2019
36 552738 UTSW Limch1 0.132 R7132 G1 225.01 N 5 66953685 F85S T C missense Het probably damaging 1.000 05/15/2019
37 552729 UTSW Lrrn4 0.082 R7132 G1 225.01 N 2 132879693 L68* A T nonsense Het probably null phenotype 05/15/2019
38 552740 UTSW Lrwd1 0.825 R7132 G1 225.01 N 5 136123275 V616A A G missense Het possibly damaging 0.708 phenotype 05/15/2019
39 552782 UTSW Nars 0.967 R7132 G1 225.01 N 18 64507770 A G critical splice donor site 2 bp Het probably null phenotype 05/15/2019
40 552754 UTSW Nradd 0.102 R7132 G1 225.01 N 9 110622261 D13G T C missense Het probably benign 0.003 phenotype 05/15/2019
41 552783 UTSW Oacyl 0.067 R7132 G1 225.01 N 18 65698409 N39I A T missense Het probably damaging 1.000 05/15/2019
42 552787 UTSW Olfr1499 0.102 R7132 G1 225.01 N 19 13815422 Q56L T A missense Het probably benign 0.095 phenotype 05/15/2019
43 552781 UTSW Onecut2 0.651 R7132 G1 225.01 N 18 64340912 H178L A T missense Het possibly damaging 0.793 phenotype 05/15/2019
44 552780 UTSW Pcdhga4 0.180 R7132 G1 225.01 N 18 37687377 T660P A C missense Het probably damaging 0.999 phenotype 05/15/2019
45 552742 UTSW Peg10 1.000 R7132 G1 181.47 N 6 4756398 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG small deletion Het probably benign phenotype 05/15/2019
46 552760 UTSW Pitpnm3 0.065 R7132 G1 213.01 N 11 72051276 I902F T A missense Het possibly damaging 0.859 phenotype 05/15/2019
47 552741 UTSW Plod3 1.000 R7132 G1 225.01 N 5 136995117 L180S T C missense Het phenotype 05/15/2019
48 552722 UTSW Prrc2c 0.441 R7132 G1 225.01 N 1 162681281 H2354Q A T missense Het possibly damaging 0.771 05/15/2019
49 552719 UTSW Pth2r 0.000 R7132 G1 225.01 N 1 65322066 E58G A G missense Het probably benign 0.003 phenotype 05/15/2019
50 552717 UTSW Rev1 0.942 R7132 G1 225.01 N 1 38071449 D573E G T missense Het possibly damaging 0.952 phenotype 05/15/2019
51 552759 UTSW Sec24a 0.000 R7132 G1 225.01 N 11 51715136 L696* A T nonsense Het probably null phenotype 05/15/2019
52 552720 UTSW Serpinb3c 0.125 R7132 G1 225.01 N 1 107276951 S22P A G missense Het probably damaging 0.964 05/15/2019
53 552716 UTSW St18 0.000 R7132 G1 225.01 N 1 6859127 H81L A T missense Het 05/15/2019
54 552727 UTSW Stard9 0.161 R7132 G1 225.01 N 2 120679378 K266* A T nonsense Het probably null 05/15/2019
55 552785 UTSW Stip1 1.000 R7132 G1 225.01 N 19 7021810 G467S C T missense Het possibly damaging 0.922 0.515 phenotype 05/15/2019
56 552756 UTSW Syne1 1.000 R7132 G1 225.01 N 10 5243180 A3956V G A missense Het probably damaging 1.000 phenotype 05/15/2019
57 552775 UTSW Tcp10a 0.080 R7132 G1 225.01 N 17 7344952 T381I C T missense Het probably benign 0.158 05/15/2019
58 552766 UTSW Tecpr2 0.000 R7132 G1 225.01 N 12 110915372 V125D T A missense Het probably damaging 0.973 phenotype 05/15/2019
59 552728 UTSW Tmc2 0.293 R7132 G1 225.01 N 2 130232409 S341P T C missense Het possibly damaging 0.820 phenotype 05/15/2019
60 552746 UTSW Tmem190 0.000 R7132 G1 225.01 N 7 4784225 V143I G A missense Het probably benign 0.127 phenotype 05/15/2019
61 552772 UTSW Trap1 0.000 R7132 G1 225.01 N 16 4055829 Y288H A G missense Het probably benign 0.168 phenotype 05/15/2019
62 552778 UTSW Trim39 0.000 R7132 G1 225.01 N 17 36260655 T404A T C missense Het probably benign 0.246 phenotype 05/15/2019
63 552725 UTSW Ttn 1.000 R7132 G1 225.01 N 2 76745699 K24950I T A missense Het probably damaging 1.000 phenotype 05/15/2019
64 552726 UTSW Ttn 1.000 R7132 G1 225.01 N 2 76944352 N2161K G T missense Het unknown phenotype 05/15/2019
65 552735 UTSW Unc13b 0.599 R7132 G1 225.01 N 4 43215757 S19P T C missense Het probably benign 0.167 phenotype 05/15/2019
66 552753 UTSW Uqcrc1 0.963 R7132 G1 222.01 N 9 108949468 I471N T A missense Het probably damaging 0.981 05/15/2019
67 552745 UTSW Wbp11 0.955 R7132 G1 225.01 N 6 136821542 T170A T C missense Het probably benign 0.240 phenotype 05/15/2019
68 552764 UTSW Wnk4 0.318 R7132 G1 225.01 N 11 101261200 I177V A G missense Het probably benign 0.224 phenotype 05/15/2019
69 552767 UTSW Zfp455 0.425 R7132 G1 225.01 N 13 67199166 P51T C A missense Het probably damaging 1.000 05/15/2019
70 552776 UTSW Zfp946 0.062 R7132 G1 225.01 N 17 22454663 Y133H T C missense Het probably benign 0.405 05/15/2019
71 552777 UTSW Zfp955a 0.096 R7132 G1 225.01 N 17 33241615 Y514* A T nonsense Het probably null 05/15/2019
72 552761 UTSW Zzef1 0.000 R7132 G1 225.01 N 11 72917871 T C critical splice donor site 2 bp Het probably null 05/15/2019
[records 1 to 72 of 72]