Incidental Mutations

101 incidental mutations are currently displayed, and affect 99 genes.
12 are Possibly Damaging.
35 are Probably Damaging.
32 are Probably Benign.
16 are Probably Null.
5 create premature stop codons.
5 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 101] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 553789 UTSW Abca14 0.000 R7146 G1 225.01 Y 7 120255297 I895F A T missense Het probably benign 0.146 0.090 05/15/2019
2 553790 UTSW Abca16 0.000 R7146 G1 225.01 Y 7 120527751 N1222D A G missense Het possibly damaging 0.455 0.179 05/15/2019
3 553834 UTSW Abcc4 0.000 R7146 G1 225.01 Y 14 118615181 Y499N A T missense Het probably damaging 0.995 0.321 phenotype 05/15/2019
4 553837 UTSW Adgrg7 0.000 R7146 G1 225.01 Y 16 56730242 C702W A C missense Het probably damaging 1.000 0.647 phenotype 05/15/2019
5 553830 UTSW Adk 1.000 R7146 G1 225.01 Y 14 21326614 P27H C A missense Het phenotype 05/15/2019
6 553778 UTSW Ankrd13a 0.129 R7146 G1 199.01 N 5 114775232 S2P T C missense Het probably damaging 0.999 05/15/2019
7 553794 UTSW Ano1 1.000 R7146 G1 225.01 Y 7 144655656 H269R T C missense Het probably benign 0.005 phenotype 05/15/2019
8 574596 UTSW Aox3 0.000 R7146 G1 225.01 Y 1 58158529 T A intron 159 bp Het probably null 09/23/2019
9 553780 UTSW Asl 0.431 R7146 G1 225.01 Y 5 130024449 G A unclassified Het probably benign phenotype 05/15/2019
10 553821 UTSW Asxl2 0.943 R7146 G1 225.01 Y 12 3457066 D86V A T missense Het probably damaging 0.999 0.493 phenotype 05/15/2019
11 574599 UTSW Ate1 1.000 R7146 G1 225.01 Y 7 130481778 A T intron Het probably null 0.976 phenotype 09/23/2019
12 553767 UTSW Bach2 0.000 R7146 G1 225.01 Y 4 32562670 D379G A G missense Het probably damaging 1.000 phenotype 05/15/2019
13 553822 UTSW Bdkrb1 0.000 R7146 G1 225.01 Y 12 105604883 L236Q T A missense Het probably damaging 1.000 phenotype 05/15/2019
14 553831 UTSW Cacna2d3 0.000 R7146 G1 144.01 Y 14 29721697 Y24C T C missense Het unknown 0.131 phenotype 05/15/2019
15 553826 UTSW Cage1 0.088 R7146 G1 225.01 Y 13 38023049 N273K G T missense Het probably benign 0.031 05/15/2019
16 553808 UTSW Ccdc51 0.635 R7146 G1 225.01 Y 9 109091780 I245N T A missense Het probably damaging 1.000 05/15/2019
17 553760 UTSW Cep152 1.000 R7146 G1 225.01 Y 2 125614405 I229V T C missense Het probably benign 0.056 phenotype 05/15/2019
18 553798 UTSW Chst4 0.060 R7146 G1 225.01 Y 8 110030731 S167C T A missense Het probably damaging 1.000 phenotype 05/15/2019
19 553799 UTSW Cntnap4 0.085 R7146 G1 225.01 Y 8 112810636 Y713F A T missense Het probably damaging 0.999 phenotype 05/15/2019
20 574597 UTSW Cntnap5b 0.108 R7146 G1 225.01 Y 1 100050794 G A splice site 5 bp Het probably null 09/23/2019
21 553797 UTSW Cog8 0.137 R7146 G1 225.01 Y 8 107052373 T424K G T missense Het possibly damaging 0.468 phenotype 05/15/2019
22 574598 UTSW Cop1 0.451 R7146 G1 111.01 Y 1 159244352 T G intron Het probably null phenotype 09/23/2019
23 553769 UTSW Cyp2j6 0.065 R7146 G1 225.01 Y 4 96545782 I97T A G missense Het probably damaging 0.999 phenotype 05/15/2019
24 553759 UTSW D430041D05Rik 0.184 R7146 G1 225.01 Y 2 104258353 T131A T C missense Het probably benign 0.062 05/15/2019
25 553820 UTSW Dnah17 0.000 R7146 G1 225.01 Y 11 118082110 D1999G T C missense Het probably damaging 0.976 phenotype 05/15/2019
26 553840 UTSW Dnah8 0.368 R7146 G1 225.01 Y 17 30644617 D250G A G missense Het probably benign 0.013 phenotype 05/15/2019
27 553841 UTSW Dnah8 0.368 R7146 G1 225.01 Y 17 30769644 V3196A T C missense Het possibly damaging 0.897 phenotype 05/15/2019
28 553838 UTSW Dscam 1.000 R7146 G1 225.01 Y 16 96829917 Y299* A T nonsense Het probably null phenotype 05/15/2019
29 553805 UTSW Ephb1 0.000 R7146 G1 225.01 Y 9 101963958 S774P A G missense Het probably damaging 1.000 phenotype 05/15/2019
30 553795 UTSW Fat1 1.000 R7146 G1 225.01 Y 8 44950925 V238I G A missense Het probably benign 0.000 phenotype 05/15/2019
31 553762 UTSW Fermt1 1.000 R7146 G1 225.01 Y 2 132934865 M234I C T missense Het probably benign 0.016 phenotype 05/15/2019
32 553755 UTSW Fmnl2 0.000 R7146 G1 225.01 Y 2 53068540 S212L C T missense Het 0.142 phenotype 05/15/2019
33 553768 UTSW Frem1 0.735 R7146 G1 225.01 Y 4 82922295 N1798S T C missense Het possibly damaging 0.929 phenotype 05/15/2019
34 553772 UTSW Gabrd 0.201 R7146 G1 225.01 Y 4 155385406 M449L T A missense Het probably benign 0.000 phenotype 05/15/2019
35 553757 UTSW Gad1 1.000 R7146 G1 225.01 Y 2 70587362 F302L T C missense Het probably benign 0.001 0.072 phenotype 05/15/2019
36 553758 UTSW Gm10800 0.285 R7146 G1 214.46 N 2 98667033 A AC frame shift Het probably null 05/15/2019
37 553816 UTSW Gm11639 0.105 R7146 G1 225.01 Y 11 104967752 N3879S A G missense Het unknown 05/15/2019
38 553817 UTSW Gm11639 0.105 R7146 G1 225.01 Y 11 105022938 D4594A A C missense Het probably benign 0.026 05/15/2019
39 553848 UTSW Gm21886 0.067 R7146 G1 140.47 N 18 80089482 GGGCCTGCAGACAGTAGGTGCTCACTAGGGCCTGTAAATAGTAGGTGCTCACTGAGGCCTGTAGACAGTAGGTGCTCA GGGCCTGTAGACAGTAGGTGCTCA small deletion Het probably benign 05/15/2019
40 553785 UTSW Gnb3 0.000 R7146 G1 225.01 Y 6 124836924 C T critical splice donor site 1 bp Het probably null phenotype 05/15/2019
41 553791 UTSW Gtf3c1 1.000 R7146 G1 225.01 Y 7 125672821 M642K A T missense Het possibly damaging 0.484 0.083 phenotype 05/15/2019
42 553763 UTSW Hps3 0.133 R7146 G1 225.01 Y 3 20008886 W838R A T missense Het probably damaging 1.000 phenotype 05/15/2019
43 553849 UTSW Ide 0.000 R7146 G1 225.01 Y 19 37295944 W527R A T missense Het phenotype 05/15/2019
44 553823 UTSW Ighe 0.051 R7146 G1 225.01 Y 12 113272355 I117N A T missense Het 05/15/2019
45 553824 UTSW Ighv1-50 0.236 R7146 G1 225.01 Y 12 115119776 E108G T C missense Het probably benign 0.266 05/15/2019
46 553765 UTSW Ivl 0.000 R7146 G1 225.01 Y 3 92572231 P176S G A missense Het probably damaging 0.966 phenotype 05/15/2019
47 553807 UTSW Lamb2 0.814 R7146 G1 225.01 Y 9 108484084 L605Q T A missense Het possibly damaging 0.945 phenotype 05/15/2019
48 553833 UTSW Lgi3 0.204 R7146 G1 225.01 Y 14 70533392 R157H G A missense Het probably damaging 0.996 05/15/2019
49 553754 UTSW Lrp1b 0.000 R7146 G1 225.01 Y 2 41375994 C1053* G T nonsense Het probably null 0.976 phenotype 05/15/2019
50 553832 UTSW Mcpt9 0.060 R7146 G1 225.01 Y 14 56026988 S217T A T missense Het probably damaging 0.998 05/15/2019
51 553811 UTSW Mgat4c 0.000 R7146 G1 225.01 Y 10 102388496 N190K T G missense Het probably damaging 1.000 05/15/2019
52 553770 UTSW Mknk1 0.000 R7146 G1 225.01 Y 4 115864592 V111D T A missense Het probably damaging 0.992 phenotype 05/15/2019
53 553810 UTSW Mmp11 0.000 R7146 G1 225.01 Y 10 75928446 T62A T C missense Het probably benign 0.000 phenotype 05/15/2019
54 553801 UTSW Mmp1b 0.077 R7146 G1 225.01 Y 9 7385014 V212F C A missense Het probably damaging 1.000 phenotype 05/15/2019
55 553802 UTSW Mmp7 0.172 R7146 G1 225.01 Y 9 7697586 A G critical splice acceptor site Het probably null phenotype 05/15/2019
56 553792 UTSW Muc5b 0.141 R7146 G1 225.01 Y 7 141863967 T3550M C T missense Het possibly damaging 0.956 0.150 phenotype 05/15/2019
57 553752 UTSW Nbeal1 0.000 R7146 G1 225.01 Y 1 60237151 V684L G C missense Het probably benign 0.110 0.120 05/15/2019
58 553806 UTSW Nphp3 1.000 R7146 G1 225.01 Y 9 104004837 K169* A T nonsense Het probably null phenotype 05/15/2019
59 553847 UTSW Npy6r 0.000 R7146 G1 225.01 Y 18 44275721 V70F G T missense Het probably benign 0.300 phenotype 05/15/2019
60 553828 UTSW Nsun2 0.918 R7146 G1 225.01 Y 13 69626553 T A critical splice donor site 2 bp Het probably null phenotype 05/15/2019
61 553836 UTSW Oplah 0.118 R7146 G1 225.01 Y 15 76302660 I652F T A missense Het probably benign 0.000 phenotype 05/15/2019
62 553764 UTSW Pcdh18 0.000 R7146 G1 225.01 Y 3 49755822 N348S T C missense Het probably damaging 1.000 phenotype 05/15/2019
63 553845 UTSW Pcdhb5 0.108 R7146 G1 225.01 Y 18 37321356 V263D T A missense Het probably damaging 1.000 0.739 phenotype 05/15/2019
64 553846 UTSW Pcdhga1 0.000 R7146 G1 225.01 Y 18 37662111 T56N C A missense Het probably benign 0.041 0.090 phenotype 05/15/2019
65 553782 UTSW Pdk4 0.000 R7146 G1 225.01 Y 6 5491068 A G critical splice donor site 2 bp Het probably null phenotype 05/15/2019
66 553825 UTSW Pfkp 0.404 R7146 G1 225.01 Y 13 6602781 V434F C A missense Het probably benign 0.001 phenotype 05/15/2019
67 553815 UTSW Phospho1 0.071 R7146 G1 225.01 Y 11 95830906 R134H G A missense Het probably damaging 0.996 phenotype 05/15/2019
68 553818 UTSW Polg2 1.000 R7146 G1 225.01 Y 11 106772746 Q374K G T missense Het probably benign 0.007 phenotype 05/15/2019
69 553761 UTSW Ptpra 0.000 R7146 G1 225.01 Y 2 130537651 T C critical splice donor site 2 bp Het probably null phenotype 05/15/2019
70 553812 UTSW Rassf3 0.153 R7146 G1 225.01 Y 10 121416147 E120K C T missense Het probably benign 0.062 phenotype 05/15/2019
71 553775 UTSW Reln 0.942 R7146 G1 225.01 Y 5 22106097 S273T A T missense Het probably damaging 0.972 phenotype 05/15/2019
72 553779 UTSW Scarb1 0.000 R7146 G1 225.01 Y 5 125284025 A133T C T missense Het probably benign 0.000 phenotype 05/15/2019
73 553756 UTSW Scn3a 1.000 R7146 G1 225.01 Y 2 65483142 K1142N T A missense Het probably damaging 0.999 0.647 phenotype 05/15/2019
74 553774 UTSW Sema3c 1.000 R7146 G1 225.01 Y 5 17694703 V398I G A missense Het probably benign 0.221 phenotype 05/15/2019
75 553781 UTSW Serpine1 0.000 R7146 G1 225.01 Y 5 137071064 Q80H C A missense Het probably damaging 1.000 phenotype 05/15/2019
76 553843 UTSW Sh3gl1 0.000 R7146 G1 225.01 Y 17 56017646 T334M G A missense Het probably damaging 0.996 phenotype 05/15/2019
77 553753 UTSW Smg7 0.941 R7146 G1 225.01 Y 1 152861825 N122D T C missense Het probably benign 0.340 phenotype 05/15/2019
78 553776 UTSW Speer4b 0.091 R7146 G1 225.01 Y 5 27498710 I144V T C missense Het probably benign 0.005 05/15/2019
79 553800 UTSW Spire2 0.130 R7146 G1 225.01 Y 8 123369250 D671E T A missense Het probably benign 0.080 05/15/2019
80 553783 UTSW Sspo 0.000 R7146 G1 225.01 Y 6 48501095 H5144L A T missense Het probably benign 0.150 05/15/2019
81 553819 UTSW Sstr2 0.774 R7146 G1 225.01 Y 11 113625353 Q366L A T missense Het probably damaging 0.996 phenotype 05/15/2019
82 553773 UTSW Ssu72 0.963 R7146 G1 225.01 Y 4 155731393 F98S T C missense Het probably damaging 0.991 05/15/2019
83 553766 UTSW Syde2 0.105 R7146 G1 225.01 Y 3 146007115 Q1003* C T nonsense Het probably null 05/15/2019
84 553842 UTSW Tapbp 0.089 R7146 G1 225.01 Y 17 33925487 A186T G A missense Het possibly damaging 0.932 phenotype 05/15/2019
85 574600 UTSW Tcf12 1.000 R7146 G1 225.01 Y 9 71883103 T A splice site 4 bp Het probably null 0.976 phenotype 09/23/2019
86 553793 UTSW Tnfrsf22 0.104 R7146 G1 225.01 Y 7 143640819 C124S A T missense Het probably damaging 1.000 05/15/2019
87 553809 UTSW Txlnb 0.056 R7146 G1 225.01 Y 10 17827798 T235S A T missense Het possibly damaging 0.812 05/15/2019
88 553804 UTSW Uaca 0.137 R7146 G1 225.01 Y 9 60870413 L694P T C missense Het probably damaging 0.994 0.647 phenotype 05/15/2019
89 553796 UTSW Unc13a 1.000 R7146 G1 225.01 Y 8 71630553 N1620Y T A missense Het probably damaging 1.000 phenotype 05/15/2019
90 553777 UTSW Vmn2r10 0.083 R7146 G1 225.01 Y 5 109003334 C138Y C T missense Het probably damaging 1.000 05/15/2019
91 553839 UTSW Vmn2r111 0.100 R7146 G1 225.01 Y 17 22559051 N549S T C missense Het possibly damaging 0.502 0.179 05/15/2019
92 553786 UTSW Vmn2r28 0.096 R7146 G1 225.01 N 7 5481496 E568D T A missense Het probably benign 0.055 05/15/2019
93 553788 UTSW Vmn2r57 0.105 R7146 G1 225.01 Y 7 41448471 H57Q A T missense Het possibly damaging 0.508 05/15/2019
94 553771 UTSW Vwa5b1 0.000 R7146 G1 225.01 Y 4 138581612 S756P A G missense Het probably benign 0.003 05/15/2019
95 553835 UTSW Washc5 0.960 R7146 G1 225.01 Y 15 59352501 E470* C A nonsense Het probably null phenotype 05/15/2019
96 553813 UTSW Xpot 0.955 R7146 G1 225.01 Y 10 121606773 V508D A T missense Het probably damaging 0.998 phenotype 05/15/2019
97 553814 UTSW Zfp616 0.000 R7146 G1 225.01 Y 11 74085261 K785N A T missense Het possibly damaging 0.605 05/15/2019
98 553803 UTSW Zfp653 0.344 R7146 G1 225.01 Y 9 22065899 N119D T C missense Het probably damaging 0.997 05/15/2019
99 553827 UTSW Zfp729b 0.109 R7146 G1 225.01 Y 13 67593376 S257P A G missense Het probably damaging 0.999 05/15/2019
100 553787 UTSW Zfp82 0.302 R7146 G1 225.01 Y 7 30056167 T497S T A missense Het probably benign 0.000 0.090 05/15/2019
[records 1 to 100 of 101] next >> last >|