Incidental Mutations

70 incidental mutations are currently displayed, and affect 69 genes.
12 are Possibly Damaging.
20 are Probably Damaging.
26 are Probably Benign.
9 are Probably Null.
3 create premature stop codons.
0 are critical splice junction mutations.
Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 70 of 70] per page Full List
 
 ID question?
 Source question?
 Gene question?
 E-score question?
  		Stock # question?
 Gen question?
 Quality
- 		Vld question?
 Strain question?
 Chr question?
 Position question?
 		 Mutation question?
 Ref
 Var
 Type question?
 Exon Dist question?
  		Zygosity question?
 Predicted Effect question?
 PPH Score question?
- 		Meta Score question?
  		MGI Phenotype question?
 Posted question?
 
1 557503 UTSW Akap13 1.000 R7159 G1 225.01 Y 7 75730579 V500E T A missense Het possibly damaging 0.722 0.571 phenotype 06/26/2019
2 557527 UTSW Ankrd34b 0.056 R7159 G1 225.01 Y 13 92439462 S401P T C missense Het probably benign 0.002 06/26/2019
3 557485 UTSW Arfgef2 0.409 R7159 G1 225.01 Y 2 166826928 D41E T A missense Het probably benign 0.000 0.058 phenotype 06/26/2019
4 557489 UTSW Arid1a 1.000 R7159 G1 148.01 Y 4 133753568 N15S T C missense Het unknown phenotype 06/26/2019
5 568632 UTSW Arsa 0.264 R7159 G1 225.01 Y 15 89474718 A T splice site Het probably null phenotype 09/05/2019
6 557512 UTSW B3gnt9 0.095 R7159 G1 225.01 Y 8 105254432 C108F C A missense Het probably damaging 1.000 06/26/2019
7 557502 UTSW Bbc3 0.000 R7159 G1 225.01 Y 7 16313808 Y152* C A nonsense Het probably null 0.906 phenotype 06/26/2019
8 557504 UTSW Btbd1 0.348 R7159 G1 225.01 Y 7 81818209 M188V T C missense Het probably benign 0.440 0.097 phenotype 06/26/2019
9 557495 UTSW Caln1 0.138 R7159 G1 225.01 Y 5 130822997 T209I C T missense Het probably benign 0.204 phenotype 06/26/2019
10 557514 UTSW Casp12 0.000 R7159 G1 225.01 Y 9 5353763 P266S C T missense Het possibly damaging 0.888 phenotype 06/26/2019
11 557484 UTSW Ccm2l 0.000 R7159 G1 225.01 Y 2 153070867 I109F A T missense Het probably damaging 0.998 0.146 phenotype 06/26/2019
12 557508 UTSW Chst15 0.079 R7159 G1 225.01 Y 7 132270258 L98R A C missense Het probably damaging 1.000 phenotype 06/26/2019
13 557525 UTSW Ctsq 0.088 R7159 G1 225.01 Y 13 61038923 M89T A G missense Het probably benign 0.002 0.090 06/26/2019
14 557539 UTSW Ddx39b 0.961 R7159 G1 225.01 Y 17 35247010 V169A T C missense Het probably benign 0.068 phenotype 06/26/2019
15 557487 UTSW Ddx58 0.177 R7159 G1 225.01 Y 4 40213804 V618A A G missense Het probably benign 0.286 phenotype 06/26/2019
16 557507 UTSW Fam57b 0.000 R7159 G1 225.01 Y 7 126827495 F80S T C missense Het probably damaging 1.000 0.698 phenotype 06/26/2019
17 557492 UTSW Fhad1 0.067 R7159 G1 225.01 Y 4 141951616 H583R T C missense Het probably benign 0.010 06/26/2019
18 557537 UTSW Fndc1 0.068 R7159 G1 225.01 Y 17 7800931 I139F T A missense Het probably damaging 0.969 06/26/2019
19 557501 UTSW Gm5724 0.063 R7159 G1 225.01 Y 6 141773778 M1L T A start codon destroyed Het probably damaging 0.997 06/26/2019
20 557478 UTSW Gm7145 0.133 R7159 G1 225.01 Y 1 117985831 H148D C G missense Het probably benign 0.011 06/26/2019
21 557516 UTSW Gpr62 0.100 R7159 G1 95.01 Y 9 106465442 A96S C A missense Het probably damaging 0.994 0.403 06/26/2019
22 568629 UTSW Gsap 0.151 R7159 G1 225.01 Y 5 21270620 T A splice site 6 bp Het probably null phenotype 09/05/2019
23 557498 UTSW Hdhd5 0.085 R7159 G1 225.01 Y 6 120523471 T89S T A missense Het probably damaging 0.998 06/26/2019
24 557499 UTSW Kcna5 0.146 R7159 G1 225.01 Y 6 126533629 Y512F T A missense Het probably damaging 1.000 phenotype 06/26/2019
25 557532 UTSW Krt84 0.095 R7159 G1 225.01 Y 15 101529609 E304* C A nonsense Het probably null phenotype 06/26/2019
26 557521 UTSW Krt9 0.000 R7159 G1 217.47 N 11 100189077 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC small deletion Het probably benign phenotype 06/26/2019
27 557500 UTSW Lrp6 0.962 R7159 G1 225.01 Y 6 134507551 V370L C A missense Het probably benign 0.000 phenotype 06/26/2019
28 557520 UTSW Lrrc3c 0.586 R7159 G1 225.01 Y 11 98599318 G167D G A missense Het probably damaging 1.000 0.151 06/26/2019
29 557511 UTSW Man2b1 0.000 R7159 G1 225.01 Y 8 85087280 T291M C T missense Het probably benign 0.094 phenotype 06/26/2019
30 557483 UTSW Mapkbp1 0.000 R7159 G1 225.01 Y 2 120025132 E1438G A G missense Het possibly damaging 0.718 06/26/2019
31 557486 UTSW Med12l 0.303 R7159 G1 225.01 Y 3 59276017 T1947A A G missense Het probably benign 0.000 phenotype 06/26/2019
32 557535 UTSW Myh15 0.176 R7159 G1 225.01 Y 16 49061574 T60S A T missense Het probably damaging 0.971 06/26/2019
33 557515 UTSW Myo5a 0.913 R7159 G1 225.01 Y 9 75171563 I868F A T missense Het probably benign 0.071 phenotype 06/26/2019
34 557490 UTSW Myom3 0.157 R7159 G1 225.01 Y 4 135808851 I1278F A T missense Het probably damaging 0.999 06/26/2019
35 568628 UTSW Nbn 1.000 R7159 G1 57.01 Y 4 15983677 G T intron Het probably null phenotype 09/05/2019
36 557536 UTSW Ncam2 0.000 R7159 G1 225.01 Y 16 81490374 S392I G T missense Het probably damaging 1.000 phenotype 06/26/2019
37 557529 UTSW Nrg3 0.217 R7159 G1 225.01 Y 14 38370735 L647* A C nonsense Het probably null phenotype 06/26/2019
38 568627 UTSW Olfr1062 0.061 R7159 G1 225.01 Y 2 86423612 T A synonymous Het probably null phenotype 09/05/2019
39 557518 UTSW Olfr1393 0.054 R7159 G1 225.01 Y 11 49280358 D70V A T missense Het probably damaging 1.000 phenotype 06/26/2019
40 557479 UTSW Olfr1406 0.094 R7159 G1 225.01 Y 1 173184323 L37Q A T missense Het possibly damaging 0.947 phenotype 06/26/2019
41 557528 UTSW Olfr721-ps1 0.064 R7159 G1 225.01 Y 14 14407251 S8P T C missense Het possibly damaging 0.945 06/26/2019
42 557541 UTSW Pcdhb9 0.098 R7159 G1 225.01 Y 18 37401492 N180D A G missense Het possibly damaging 0.893 06/26/2019
43 557542 UTSW Pcdhga4 0.117 R7159 G1 225.01 Y 18 37686919 N507S A G missense Het probably damaging 0.997 phenotype 06/26/2019
44 557506 UTSW Pdilt 0.141 R7159 G1 225.01 Y 7 119487951 V492A A G missense Het probably benign 0.007 0.090 phenotype 06/26/2019
45 557519 UTSW Phf12 0.687 R7159 G1 225.01 Y 11 78023540 T603A A G missense Het possibly damaging 0.757 06/26/2019
46 557493 UTSW Phox2b 1.000 R7159 G1 225.01 Y 5 67097585 I174F T A missense Het probably benign 0.002 phenotype 06/26/2019
47 557534 UTSW Polq 0.384 R7159 G1 225.01 Y 16 37062853 Q1793L A T missense Het possibly damaging 0.873 phenotype 06/26/2019
48 557510 UTSW Prmt9 0.567 R7159 G1 225.01 Y 8 77555764 F97L T C missense Het probably benign 0.014 0.087 06/26/2019
49 557522 UTSW Prpsap1 0.092 R7159 G1 225.01 Y 11 116494044 E13G T C missense Het probably benign 0.258 06/26/2019
50 557488 UTSW Ptpru 0.000 R7159 G1 225.01 Y 4 131819540 L280P A G missense Het probably damaging 0.998 phenotype 06/26/2019
51 557523 UTSW Pygl 0.265 R7159 G1 225.01 Y 12 70197406 M587K A T missense Het probably benign 0.409 phenotype 06/26/2019
52 557480 UTSW Rc3h2 0.000 R7159 G1 225.01 Y 2 37409647 S124G T C missense Het probably benign 0.388 phenotype 06/26/2019
53 557517 UTSW Rdh5 0.534 R7159 G1 225.01 Y 10 128918315 I83T A G missense Het possibly damaging 0.860 phenotype 06/26/2019
54 557524 UTSW Ryr2 1.000 R7159 G1 225.01 Y 13 11810908 R561S T G missense Het probably damaging 0.987 phenotype 06/26/2019
55 557530 UTSW Scara3 0.090 R7159 G1 225.01 Y 14 65920780 L593P A G missense Het probably damaging 0.979 phenotype 06/26/2019
56 557494 UTSW Scfd2 0.127 R7159 G1 225.01 Y 5 74531343 I93V T C missense Het probably benign 0.011 06/26/2019
57 557496 UTSW Sema4f 0.000 R7159 G1 225.01 Y 6 82917883 V444L C A missense Het possibly damaging 0.633 phenotype 06/26/2019
58 557513 UTSW Spata33 0.067 R7159 G1 225.01 Y 8 123214395 L61P T C missense Het unknown 06/26/2019
59 568631 UTSW Stard10 0.000 R7159 G1 211.01 Y 7 101343136 A T intron Het probably null 0.976 phenotype 09/05/2019
60 557538 UTSW Stub1 0.759 R7159 G1 225.01 Y 17 25832064 I115V T C missense Het probably benign 0.129 0.147 phenotype 06/26/2019
61 557540 UTSW Tmem247 0.056 R7159 G1 225.01 Y 17 86918282 T50I C T missense Het probably benign 0.000 06/26/2019
62 557531 UTSW Tnrc6b 0.285 R7159 G1 225.01 Y 15 80887022 M1103V A G missense Het possibly damaging 0.915 phenotype 06/26/2019
63 557509 UTSW Trim61 0.110 R7159 G1 225.01 Y 8 65013874 Y245C T C missense Het probably benign 0.192 06/26/2019
64 557526 UTSW Trip13 0.941 R7159 G1 225.01 Y 13 73920011 I284V T C missense Het probably benign 0.042 0.131 phenotype 06/26/2019
65 568630 UTSW Trpm4 0.166 R7159 G1 225.01 Y 7 45327268 T C splice site 4 bp Het probably null 0.976 phenotype 09/05/2019
66 557481 UTSW Ttn 1.000 R7159 G1 225.01 Y 2 76730574 L29161S A G missense Het probably damaging 1.000 phenotype 06/26/2019
67 557482 UTSW Ttn 1.000 R7159 G1 225.01 Y 2 76909748 L3528F C A missense Het unknown phenotype 06/26/2019
68 557533 UTSW Ube2v2 R7159 G1 225.01 Y 16 15581084 T47I G A missense Het probably benign 0.002 phenotype 06/26/2019
69 557491 UTSW Vwa5b1 0.000 R7159 G1 225.01 Y 4 138575422 A921T C T missense Het possibly damaging 0.558 06/26/2019
70 557505 UTSW Xylt1 0.331 R7159 G1 225.01 Y 7 117637602 F526Y T A missense Het probably damaging 1.000 0.499 phenotype 06/26/2019
[records 1 to 70 of 70]