Incidental Mutations

76 incidental mutations are currently displayed, and affect 76 genes.
9 are Possibly Damaging.
30 are Probably Damaging.
27 are Probably Benign.
5 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 76 of 76] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 558864 UTSW Acot13 R7179 G1 225.01 Y 13 24818171 I96K A T missense Het probably benign 0.015 phenotype 06/26/2019
2 558862 UTSW Adam6a 0.086 R7179 G1 225.01 Y 12 113545671 T555A A G missense Het probably benign 0.023 06/26/2019
3 558831 UTSW Alms1 0.000 R7179 G1 225.01 Y 6 85621369 P1059L C T missense Het probably benign 0.085 0.090 phenotype 06/26/2019
4 558872 UTSW Apol7c 0.051 R7179 G1 225.01 Y 15 77525643 T368A T C missense Het probably benign 0.010 0.090 06/26/2019
5 558844 UTSW Arfgef3 0.239 R7179 G1 225.01 Y 10 18599267 L1557Q A T missense Het probably damaging 1.000 phenotype 06/26/2019
6 558851 UTSW Baz2a 0.000 R7179 G1 225.01 Y 10 128124457 R1514W C T missense Het probably damaging 0.984 06/26/2019
7 558829 UTSW Bmp3 0.000 R7179 G1 225.01 Y 5 98872763 D348E T A missense Het probably damaging 1.000 0.069 phenotype 06/26/2019
8 558848 UTSW Bves 0.000 R7179 G1 190.01 Y 10 45354817 S295G A G missense Het probably damaging 0.998 0.093 phenotype 06/26/2019
9 558863 UTSW Carmil1 0.000 R7179 G1 225.01 Y 13 24020069 C1328R A G missense Het probably benign 0.002 phenotype 06/26/2019
10 558861 UTSW Ccnk 1.000 R7179 G1 225.01 Y 12 108187258 Y93N T A missense Het probably damaging 1.000 phenotype 06/26/2019
11 558843 UTSW Ccr1 0.130 R7179 G1 225.01 Y 9 123964052 V147D A T missense Het probably damaging 0.998 phenotype 06/26/2019
12 558847 UTSW Cd24a 0.000 R7179 G1 225.01 Y 10 43582640 G36S G A missense Het probably benign 0.066 0.090 phenotype 06/26/2019
13 558828 UTSW Cep104 0.185 R7179 G1 225.01 Y 4 153992867 Y569C A G missense Het probably damaging 0.993 phenotype 06/26/2019
14 558834 UTSW Chd2 0.703 R7179 G1 225.01 Y 7 73475420 I884N A T missense Het probably damaging 1.000 phenotype 06/26/2019
15 558811 UTSW Cnst 0.150 R7179 G1 225.01 Y 1 179579382 A T start gained Het probably benign phenotype 06/26/2019
16 558871 UTSW Col22a1 0.000 R7179 G1 225.01 Y 15 71933413 L146P A G missense Het unknown 0.079 phenotype 06/26/2019
17 558825 UTSW Col25a1 0.112 R7179 G1 225.01 Y 3 130530119 R321L G T missense Het probably damaging 0.990 0.232 phenotype 06/26/2019
18 558870 UTSW Ctnnd2 0.000 R7179 G1 225.01 Y 15 30683364 Y504H T C missense Het possibly damaging 0.947 phenotype 06/26/2019
19 558821 UTSW D3Ertd751e 0.086 R7179 G1 225.01 Y 3 41748708 Q73K C A missense Het probably damaging 0.962 0.132 06/26/2019
20 558877 UTSW Dsc2 0.000 R7179 G1 225.01 Y 18 20035275 C T critical splice donor site 1 bp Het probably null phenotype 06/26/2019
21 558806 UTSW Eya1 0.859 R7179 G1 225.01 Y 1 14302852 S14R A T missense Het probably damaging 0.999 phenotype 06/26/2019
22 574573 UTSW Fam131c 0.057 R7179 G1 115.01 Y 4 141383017 A T intron 163 bp Het probably null 09/18/2019
23 558812 UTSW Fam71a 0.071 R7179 G1 225.01 Y 1 191164021 R142C G A missense Het probably damaging 1.000 0.647 phenotype 06/26/2019
24 558860 UTSW Flvcr2 0.780 R7179 G1 225.01 Y 12 85747191 F114L T C missense Het possibly damaging 0.943 0.313 phenotype 06/26/2019
25 558846 UTSW Fyn 1.000 R7179 G1 225.01 Y 10 39532124 D321G A G missense Het possibly damaging 0.905 0.588 phenotype 06/26/2019
26 558816 UTSW Galnt5 0.000 R7179 G1 225.01 Y 2 57998609 M74L A C missense Het probably benign 0.065 phenotype 06/26/2019
27 558854 UTSW Gas2l2 0.000 R7179 G1 225.01 Y 11 83422462 P675S G A missense Het probably benign 0.088 phenotype 06/26/2019
28 558849 UTSW Gm9508 R7179 G1 225.01 Y 10 77696636 Q200K G T missense Het unknown 0.242 06/26/2019
29 558876 UTSW Greb1l 1.000 R7179 G1 225.01 Y 18 10544576 S1390N G A missense Het probably benign 0.001 06/26/2019
30 558856 UTSW Hdac5 0.000 R7179 G1 225.01 Y 11 102204559 T430K G T missense Het possibly damaging 0.740 phenotype 06/26/2019
31 558810 UTSW Hjurp 0.912 R7179 G1 217.47 Y 1 88266278 TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT utr 3 prime Het probably benign 06/26/2019
32 558869 UTSW Khnyn 0.085 R7179 G1 225.01 Y 14 55894354 P578S C T missense Het probably damaging 1.000 phenotype 06/26/2019
33 558826 UTSW Lepr 0.000 R7179 G1 225.01 Y 4 101745659 T215S A T missense Het probably benign 0.062 phenotype 06/26/2019
34 558859 UTSW Lrfn5 0.101 R7179 G1 225.01 Y 12 61843982 V686I G A missense Het probably benign 0.000 0.066 phenotype 06/26/2019
35 558815 UTSW Mapkap1 1.000 R7179 G1 225.01 Y 2 34518700 H233Q T A missense Het possibly damaging 0.883 phenotype 06/26/2019
36 558807 UTSW Mcm3 1.000 R7179 G1 225.01 Y 1 20814857 I201T A G missense Het probably damaging 0.982 phenotype 06/26/2019
37 558857 UTSW Metrnl 0.000 R7179 G1 225.01 Y 11 121715908 R263Q G A missense Het probably damaging 0.987 06/26/2019
38 558873 UTSW Mettl22 0.000 R7179 G1 225.01 Y 16 8478060 E71G A G missense Het probably benign 0.002 phenotype 06/26/2019
39 558839 UTSW Muc16 0.127 R7179 G1 225.01 Y 9 18642008 T4330A T C missense Het probably benign 0.005 phenotype 06/26/2019
40 558832 UTSW Mug1 0.000 R7179 G1 211.01 Y 6 121857420 T387A A G missense Het probably benign 0.001 phenotype 06/26/2019
41 558853 UTSW Myh4 0.294 R7179 G1 225.01 Y 11 67244724 D379G A G missense Het probably benign 0.319 phenotype 06/26/2019
42 558858 UTSW Nbas 1.000 R7179 G1 225.01 Y 12 13405397 D1204G A G missense Het possibly damaging 0.944 phenotype 06/26/2019
43 558830 UTSW Ncor2 1.000 R7179 G1 225.01 Y 5 125055783 K478E T C missense Het unknown 0.705 phenotype 06/26/2019
44 558874 UTSW Olfr173 0.075 R7179 G1 225.01 Y 16 58796887 I320F T A missense Het probably benign 0.003 phenotype 06/26/2019
45 558835 UTSW Olfr294 0.138 R7179 G1 225.01 Y 7 86616366 L93Q A T missense Het possibly damaging 0.758 phenotype 06/26/2019
46 558836 UTSW Olfr557 0.134 R7179 G1 225.01 Y 7 102698270 T11A A G missense Het probably benign 0.001 phenotype 06/26/2019
47 558855 UTSW Osbpl7 0.182 R7179 G1 225.01 Y 11 97050836 V62I G A missense Het probably benign 0.050 phenotype 06/26/2019
48 558866 UTSW Pak1ip1 1.000 R7179 G1 225.01 Y 13 41009542 N246S A G missense Het probably damaging 0.966 phenotype 06/26/2019
49 558850 UTSW Prim1 0.959 R7179 G1 225.01 Y 10 128015976 Y39C A G missense Het probably damaging 0.999 phenotype 06/26/2019
50 558865 UTSW Prl3b1 0.084 R7179 G1 225.01 Y 13 27243844 V46L G T missense Het probably benign 0.055 06/26/2019
51 558838 UTSW Prss54 0.056 R7179 G1 225.01 Y 8 95565571 S127T A T missense Het probably benign 0.034 phenotype 06/26/2019
52 558875 UTSW Rasal3 0.054 R7179 G1 225.01 Y 17 32392417 T912M G A missense Het probably damaging 0.992 0.157 phenotype 06/26/2019
53 558878 UTSW Rrp12 0.943 R7179 G1 225.01 Y 19 41883778 T420S T A missense Het probably benign 0.028 0.073 06/26/2019
54 558827 UTSW Rspo1 0.000 R7179 G1 225.01 Y 4 125005038 N51D A G missense Het probably damaging 1.000 phenotype 06/26/2019
55 558809 UTSW Rufy4 0.246 R7179 G1 225.01 Y 1 74132876 R253G A G missense Het probably benign 0.119 06/26/2019
56 558833 UTSW Scaf1 0.913 R7179 G1 225.01 Y 7 45007743 R571C G A missense Het unknown 0.087 06/26/2019
57 558817 UTSW Scn2a 1.000 R7179 G1 225.01 Y 2 65701979 H645L A T missense Het probably damaging 0.996 0.119 phenotype 06/26/2019
58 558824 UTSW Sec24b 0.762 R7179 G1 225.01 Y 3 129988946 S1132P A G missense Het probably damaging 1.000 0.660 phenotype 06/26/2019
59 558819 UTSW Slc1a2 0.582 R7179 G1 225.01 Y 2 102755945 K298R A G missense Het probably damaging 1.000 phenotype 06/26/2019
60 558822 UTSW Slc25a54 0.344 R7179 G1 225.01 Y 3 109107257 N230K T A missense Het probably benign 0.001 06/26/2019
61 558814 UTSW Slc27a4 1.000 R7179 G1 225.01 Y 2 29815652 Y617* T G nonsense Het probably null phenotype 06/26/2019
62 558820 UTSW Slc2a10 0.105 R7179 G1 225.01 Y 2 165515349 S310P T C missense Het probably damaging 0.998 phenotype 06/26/2019
63 558840 UTSW Snx33 0.061 R7179 G1 225.01 Y 9 56925867 R306H C T missense Het probably damaging 1.000 0.647 phenotype 06/26/2019
64 574574 UTSW Spag9 0.763 R7179 G1 122.01 Y 11 94089432 A T intron Het probably null phenotype 09/18/2019
65 574572 UTSW Spg11 0.138 R7179 G1 225.01 Y 2 122101789 A T splice site Het probably null phenotype 09/18/2019
66 558867 UTSW Sycp2l 0.126 R7179 G1 225.01 Y 13 41129782 T165A A G missense Het probably damaging 0.998 phenotype 06/26/2019
67 558813 UTSW Syt14 0.000 R7179 G1 225.01 Y 1 192933263 C189R A G missense Het probably damaging 1.000 phenotype 06/26/2019
68 558845 UTSW Taar9 0.112 R7179 G1 225.01 Y 10 24108984 L184Q A T missense Het probably damaging 0.997 phenotype 06/26/2019
69 558868 UTSW Tkt 1.000 R7179 G1 183.01 Y 14 30559858 P111L C T missense Het probably damaging 1.000 0.938 phenotype 06/26/2019
70 558842 UTSW Trpc1 0.221 R7179 G1 225.01 Y 9 95721144 L445Q A T missense Het possibly damaging 0.818 phenotype 06/26/2019
71 558823 UTSW Usp53 0.161 R7179 G1 225.01 Y 3 122949710 S526P A G missense Het probably benign 0.012 phenotype 06/26/2019
72 558852 UTSW Vps54 0.938 R7179 G1 225.01 Y 11 21298791 W447G T G missense Het probably damaging 1.000 phenotype 06/26/2019
73 558818 UTSW Xirp2 0.264 R7179 G1 225.01 Y 2 67509833 H806L A T missense Het probably benign 0.001 phenotype 06/26/2019
74 558808 UTSW Zfp451 0.000 R7179 G1 225.01 Y 1 33802570 H410Q A T missense Het unknown 06/26/2019
75 558837 UTSW Zfp688 0.085 R7179 G1 225.01 Y 7 127419312 C214R A G missense Het probably damaging 1.000 06/26/2019
76 558841 UTSW Zic4 0.241 R7179 G1 225.01 Y 9 91379121 D143G A G missense Het possibly damaging 0.888 phenotype 06/26/2019
[records 1 to 76 of 76]