Incidental Mutations

80 incidental mutations are currently displayed, and affect 80 genes.
11 are Possibly Damaging.
31 are Probably Damaging.
29 are Probably Benign.
8 are Probably Null.
3 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 80 of 80] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 558889 UTSW Acnat2 0.067 R7180 G1 225.01 Y 4 49381803 Y196* A C nonsense Het probably null 06/26/2019
2 558893 UTSW Agrn 0.573 R7180 G1 225.01 Y 4 156171839 R1405H C T missense Het probably benign 0.002 phenotype 06/26/2019
3 558933 UTSW Agtpbp1 0.776 R7180 G1 225.01 Y 13 59466038 H1030Y G A missense Het probably benign 0.107 phenotype 06/26/2019
4 558917 UTSW Ankrd37 0.197 R7180 G1 225.01 Y 8 45999854 C T unclassified Het probably benign 06/26/2019
5 558936 UTSW Ap1g2 0.369 R7180 G1 225.01 Y 14 55104451 P218R G C missense Het probably damaging 1.000 phenotype 06/26/2019
6 568514 UTSW Ap2a1 0.358 R7180 G1 54.01 Y 7 44923804 C T intron 5476 bp Het probably null phenotype 08/15/2019
7 558926 UTSW Apc2 0.310 R7180 G1 219.01 Y 10 80311156 D681E T A missense Het possibly damaging 0.941 phenotype 06/26/2019
8 558902 UTSW Arhgef5 0.000 R7180 G1 225.01 Y 6 43275208 N964K T A missense Het possibly damaging 0.871 phenotype 06/26/2019
9 558884 UTSW BC028528 0.098 R7180 G1 214.46 N 3 95888136 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT small insertion Het probably benign 06/26/2019
10 558944 UTSW Ccnf 1.000 R7180 G1 225.01 Y 17 24223915 M773L T A missense Het probably benign 0.002 0.062 phenotype 06/26/2019
11 558920 UTSW Ces1e 0.000 R7180 G1 225.01 Y 8 93215144 S234A A C missense Het probably damaging 0.996 phenotype 06/26/2019
12 558921 UTSW Ces1g 0.065 R7180 G1 225.01 Y 8 93302948 E552V T A missense Het probably benign 0.038 phenotype 06/26/2019
13 568512 UTSW Ctcfl 0.348 R7180 G1 168.01 Y 2 173105977 A T intron 55 bp Het probably null 0.976 phenotype 08/15/2019
14 558888 UTSW Dkk2 0.363 R7180 G1 225.01 Y 3 132086192 S54T T A missense Het probably damaging 0.998 phenotype 06/26/2019
15 558943 UTSW Dll1 1.000 R7180 G1 225.01 Y 17 15374869 S49P A G missense Het probably benign 0.027 0.090 phenotype 06/26/2019
16 558942 UTSW Dscam 1.000 R7180 G1 225.01 Y 16 96825564 A382S C A missense Het probably damaging 0.974 phenotype 06/26/2019
17 558879 UTSW Eif5b 1.000 R7180 G1 225.01 Y 1 38049074 M1020L A T missense Het probably damaging 0.978 0.190 phenotype 06/26/2019
18 558946 UTSW Enpp4 0.253 R7180 G1 225.01 Y 17 44102037 D202G T C missense Het probably benign 0.028 06/26/2019
19 558908 UTSW Eps8 0.434 R7180 G1 225.01 Y 6 137479074 I803N A T missense Het possibly damaging 0.777 phenotype 06/26/2019
20 558913 UTSW Etv2 1.000 R7180 G1 225.01 Y 7 30635649 G28V C A missense Het probably damaging 0.996 phenotype 06/26/2019
21 558916 UTSW Fadd 1.000 R7180 G1 225.01 Y 7 144580785 V121E A T missense Het probably damaging 1.000 phenotype 06/26/2019
22 558935 UTSW Fam149b 0.350 R7180 G1 225.01 Y 14 20381785 Y545H T C missense Het probably benign 0.008 06/26/2019
23 558929 UTSW Fam196b 0.076 R7180 G1 225.01 Y 11 34419873 K526E A G missense Het probably damaging 0.998 phenotype 06/26/2019
24 558932 UTSW Fbxl21 0.000 R7180 G1 225.01 Y 13 56523527 M1L A T start codon destroyed Het probably benign 0.008 0.090 phenotype 06/26/2019
25 558883 UTSW Flg2 0.091 R7180 G1 225.01 Y 3 93202833 S723P T C missense Het unknown 06/26/2019
26 558914 UTSW Gm4884 0.087 R7180 G1 225.01 Y 7 41044209 T534I C T missense Het possibly damaging 0.887 06/26/2019
27 558907 UTSW Gm8994 0.935 R7180 G1 225.01 Y 6 136329537 I332N T A missense Het probably damaging 1.000 06/26/2019
28 558880 UTSW Gpbar1 0.000 R7180 G1 225.01 Y 1 74278633 I12F A T missense Het possibly damaging 0.645 phenotype 06/26/2019
29 558949 UTSW Gpr151 0.000 R7180 G1 225.01 Y 18 42578956 L219* A T nonsense Het probably null 0.965 phenotype 06/26/2019
30 568516 UTSW Hdgfl2 0.266 R7180 G1 225.01 Y 17 56097532 T A splice site 6 bp Het probably null phenotype 08/15/2019
31 558898 UTSW Hectd4 0.851 R7180 G1 225.01 Y 5 121308342 M200V A G missense Het probably benign 0.014 06/26/2019
32 558897 UTSW Idua 0.147 R7180 G1 225.01 Y 5 108680895 N335S A G missense Het probably benign 0.430 0.089 phenotype 06/26/2019
33 558953 UTSW Ifit1bl1 0.000 R7180 G1 199.01 Y 19 34593902 F385Y A T missense Het probably damaging 0.997 06/26/2019
34 558895 UTSW Ift172 1.000 R7180 G1 225.01 Y 5 31254262 D1624G T C missense Het probably damaging 1.000 phenotype 06/26/2019
35 558923 UTSW Igsf9b 0.791 R7180 G1 225.01 Y 9 27322668 T388S A T missense Het possibly damaging 0.953 06/26/2019
36 558890 UTSW Ikbkap 1.000 R7180 G1 225.01 Y 4 56796535 S118R A T missense Het probably damaging 1.000 phenotype 06/26/2019
37 558952 UTSW Jak2 1.000 R7180 G1 225.01 Y 19 29282411 I237V A G missense Het probably benign 0.007 phenotype 06/26/2019
38 558951 UTSW Kat5 1.000 R7180 G1 225.01 Y 19 5603961 K398N C A missense Het probably damaging 0.994 phenotype 06/26/2019
39 558937 UTSW Lmbrd2 0.152 R7180 G1 225.01 Y 15 9175196 V398E T A missense Het possibly damaging 0.900 06/26/2019
40 558927 UTSW Lrp1 1.000 R7180 G1 225.01 Y 10 127556965 N2744D T C missense Het probably damaging 0.999 phenotype 06/26/2019
41 558894 UTSW Lrrd1 0.438 R7180 G1 225.01 Y 5 3851459 I588T T C missense Het probably damaging 0.995 06/26/2019
42 558941 UTSW Ltn1 1.000 R7180 G1 225.01 Y 16 87418494 F418L A G missense Het probably damaging 0.979 0.504 phenotype 06/26/2019
43 558904 UTSW Magi1 0.343 R7180 G1 225.01 Y 6 93815750 D169V T A missense Het probably benign 0.098 phenotype 06/26/2019
44 558891 UTSW Mpdz 0.000 R7180 G1 225.01 Y 4 81335751 E1048G T C missense Het probably damaging 0.980 phenotype 06/26/2019
45 558939 UTSW Myh9 1.000 R7180 G1 225.01 Y 15 77807910 I150V T C missense Het probably benign 0.001 0.106 phenotype 06/26/2019
46 558882 UTSW Nckap1 1.000 R7180 G1 225.01 Y 2 80506892 M1006K A T missense Het probably benign 0.011 0.650 phenotype 06/26/2019
47 558892 UTSW Nkain1 0.203 R7180 G1 225.01 Y 4 130533925 V132I C T missense Het probably benign 0.019 phenotype 06/26/2019
48 558950 UTSW Npy6r 0.000 R7180 G1 225.01 Y 18 44276156 M215L A T missense Het probably benign 0.000 0.090 phenotype 06/26/2019
49 558919 UTSW Nr3c2 1.000 R7180 G1 225.01 Y 8 76908963 Q231L A T missense Het probably damaging 0.988 phenotype 06/26/2019
50 558912 UTSW Obox5 0.140 R7180 G1 225.01 Y 7 15757924 P88L C T missense Het probably benign 0.001 06/26/2019
51 558915 UTSW Olfr514 0.123 R7180 G1 225.01 Y 7 108825979 S7P A G missense Het probably damaging 0.979 phenotype 06/26/2019
52 558928 UTSW Olfr827 0.093 R7180 G1 225.01 Y 10 130210942 T63A T C missense Het probably benign 0.053 0.090 phenotype 06/26/2019
53 558899 UTSW P2rx7 0.000 R7180 G1 225.01 Y 5 122680820 D435G A G missense Het possibly damaging 0.892 phenotype 06/26/2019
54 558938 UTSW Pdzd2 0.182 R7180 G1 225.01 Y 15 12376123 S1309C T A missense Het probably damaging 0.991 phenotype 06/26/2019
55 568513 UTSW Pex5l 0.483 R7180 G1 225.01 Y 3 33024691 C T splice site 5 bp Het probably null phenotype 08/15/2019
56 558900 UTSW Pip 0.055 R7180 G1 225.01 Y 6 41847631 C18S T A missense Het probably damaging 1.000 phenotype 06/26/2019
57 558945 UTSW Pla2g7 0.000 R7180 G1 225.01 Y 17 43599076 T157M C T missense Het probably damaging 1.000 phenotype 06/26/2019
58 558954 UTSW Plce1 0.705 R7180 G1 225.01 Y 19 38779785 Y2168C A G missense Het probably damaging 1.000 phenotype 06/26/2019
59 558881 UTSW Rgs2 0.191 R7180 G1 225.01 Y 1 144002148 T137A T C missense Het probably benign 0.035 phenotype 06/26/2019
60 558905 UTSW Rpl32 0.000 R7180 G1 225.01 Y 6 115807807 I31F T A missense Het possibly damaging 0.943 06/26/2019
61 558931 UTSW Ryr2 1.000 R7180 G1 225.01 Y 13 11686978 Y2931C T C missense Het probably damaging 0.999 phenotype 06/26/2019
62 558896 UTSW Slc4a4 1.000 R7180 G1 225.01 Y 5 89046236 E192K G A missense Het probably damaging 0.972 phenotype 06/26/2019
63 558934 UTSW Slc4a7 0.922 R7180 G1 225.01 Y 14 14765580 A521T G A missense Het probably damaging 0.999 phenotype 06/26/2019
64 558947 UTSW Smchd1 0.726 R7180 G1 225.01 Y 17 71394823 E1058G T C missense Het probably damaging 0.993 phenotype 06/26/2019
65 558955 UTSW Sorbs1 0.766 R7180 G1 225.01 Y 19 40376800 R180G G C missense Het probably benign 0.000 0.090 phenotype 06/26/2019
66 558910 UTSW Ssc5d 0.000 R7180 G1 225.01 Y 7 4936601 T679A A G missense Het probably benign 0.168 06/26/2019
67 558906 UTSW Tas2r130 0.073 R7180 G1 225.01 Y 6 131630248 S195A A C missense Het probably benign 0.002 0.090 phenotype 06/26/2019
68 558901 UTSW Tas2r135 0.061 R7180 G1 225.01 Y 6 42405751 R75* C T nonsense Het probably null 06/26/2019
69 558922 UTSW Terf2ip 1.000 R7180 G1 225.01 Y 8 112011420 G T unclassified Het probably benign phenotype 06/26/2019
70 558918 UTSW Tm6sf2 0.000 R7180 G1 225.01 Y 8 70076006 R136K G A missense Het probably benign 0.225 phenotype 06/26/2019
71 558940 UTSW Tmprss15 0.000 R7180 G1 225.01 Y 16 78967998 L858P A G missense Het probably damaging 0.970 phenotype 06/26/2019
72 558925 UTSW Topaz1 0.194 R7180 G1 225.01 Y 9 122797705 D1466G A G missense Het possibly damaging 0.845 phenotype 06/26/2019
73 558924 UTSW Trip4 0.849 R7180 G1 225.01 Y 9 65857345 L446Q A T missense Het probably damaging 1.000 phenotype 06/26/2019
74 558930 UTSW Trpv3 0.094 R7180 G1 225.01 Y 11 73277992 V93L G T missense Het probably benign 0.000 phenotype 06/26/2019
75 558887 UTSW Ubl4b R7180 G1 225.01 Y 3 107554646 H99Q A T missense Het probably damaging 0.999 06/26/2019
76 568515 UTSW Unc45a 1.000 R7180 G1 159.01 Y 7 80329821 A T intron Het probably null phenotype 08/15/2019
77 558903 UTSW Vmn1r47 0.059 R7180 G1 225.01 Y 6 90022353 A156S G T missense Het probably damaging 0.997 06/26/2019
78 558911 UTSW Vmn2r33 R7180 G1 96.01 N 7 7563897 H72L T A missense Het probably benign 0.005 06/26/2019
79 558948 UTSW Zeb1 0.928 R7180 G1 225.01 Y 18 5767867 V793M G A missense Het possibly damaging 0.941 phenotype 06/26/2019
80 558909 UTSW Zfp628 0.424 R7180 G1 225.01 Y 7 4921064 Q762K C A missense Het probably benign 0.176 phenotype 06/26/2019
[records 1 to 80 of 80]