Incidental Mutations

65 incidental mutations are currently displayed, and affect 64 genes.
11 are Possibly Damaging.
25 are Probably Damaging.
21 are Probably Benign.
5 are Probably Null.
0 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 65 of 65] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 559248 UTSW 1600002K03Rik R7185 G1 225.01 Y 10 80173129 G55E G A missense Het probably damaging 1.000 0.647 06/26/2019
2 559243 UTSW 2610044O15Rik8 0.128 R7185 G1 147.01 Y 8 129220021 C108S A T missense Het probably benign 0.377 06/26/2019
3 559249 UTSW 4930430F08Rik 0.133 R7185 G1 225.01 Y 10 100589211 T C start gained Het probably benign 06/26/2019
4 559251 UTSW Afmid 0.000 R7185 G1 225.01 Y 11 117834773 D95E T A missense Het possibly damaging 0.658 phenotype 06/26/2019
5 559257 UTSW Ak7 0.000 R7185 G1 225.01 Y 12 105742276 E330G A G missense Het probably damaging 0.997 0.218 phenotype 06/26/2019
6 559209 UTSW B3gat2 0.412 R7185 G1 195.01 Y 1 23763191 D186A A C missense Het probably damaging 0.999 phenotype 06/26/2019
7 559256 UTSW Baz1a 0.000 R7185 G1 225.01 Y 12 54975308 T63M G A missense Het probably damaging 1.000 0.882 phenotype 06/26/2019
8 559260 UTSW Bhmt2 0.116 R7185 G1 225.01 Y 13 93663271 M219K A T missense Het probably benign 0.216 0.443 phenotype 06/26/2019
9 559265 UTSW Cd200r1 0.057 R7185 G1 225.01 Y 16 44789612 T65A A G missense Het probably benign 0.297 phenotype 06/26/2019
10 559222 UTSW Cdc14a 0.231 R7185 G1 225.01 Y 3 116294027 E494G T C missense Het probably benign 0.000 phenotype 06/26/2019
11 559214 UTSW Cenpf 0.510 R7185 G1 225.01 Y 1 189653489 L2198P A G missense Het probably damaging 1.000 phenotype 06/26/2019
12 559241 UTSW Col4a2 1.000 R7185 G1 225.01 Y 8 11399739 D117E T A missense Het probably damaging 0.994 0.075 phenotype 06/26/2019
13 559212 UTSW Ddr2 0.000 R7185 G1 225.01 Y 1 169987054 V607L C A missense Het probably damaging 1.000 0.514 phenotype 06/26/2019
14 559225 UTSW Dennd4c 1.000 R7185 G1 225.01 Y 4 86811450 Y763C A G missense Het probably damaging 1.000 0.217 06/26/2019
15 559267 UTSW Ecscr 0.000 R7185 G1 225.01 Y 18 35716804 T93S T A missense Het probably benign 0.012 0.090 phenotype 06/26/2019
16 559236 UTSW Eogt 0.241 R7185 G1 225.01 Y 6 97120178 R321H C T missense Het probably damaging 1.000 phenotype 06/26/2019
17 559231 UTSW Fras1 0.000 R7185 G1 225.01 Y 5 96636776 S873P T C missense Het probably damaging 1.000 phenotype 06/26/2019
18 559239 UTSW Gm29735 R7185 G1 128.59 Y 7 142156529 ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA small deletion Het probably benign 06/26/2019
19 559262 UTSW Gm8247 R7185 G1 178.01 N 14 44586402 I182V A G missense Het 06/26/2019
20 559213 UTSW Gpatch2 0.102 R7185 G1 225.01 Y 1 187226197 S250P T C missense Het probably damaging 0.999 phenotype 06/26/2019
21 559245 UTSW Gramd1b 0.101 R7185 G1 225.01 Y 9 40333563 D183G T C missense Het probably benign 0.030 06/26/2019
22 559216 UTSW Hspa5 1.000 R7185 G1 225.01 Y 2 34775126 V433A T C missense Het probably damaging 0.998 phenotype 06/26/2019
23 559234 UTSW Igkv8-30 0.162 R7185 G1 225.01 Y 6 70117606 Q4H C A missense Het probably benign 0.015 06/26/2019
24 559235 UTSW Igkv8-30 0.162 R7185 G1 225.01 Y 6 70117607 Q4P T G missense Het probably damaging 0.978 06/26/2019
25 559244 UTSW Kcnj5 0.000 R7185 G1 225.01 Y 9 32322176 N281T T G missense Het probably damaging 0.996 phenotype 06/26/2019
26 559226 UTSW L1td1 0.093 R7185 G1 225.01 Y 4 98736618 E350G A G missense Het possibly damaging 0.719 phenotype 06/26/2019
27 559246 UTSW Layn 0.063 R7185 G1 225.01 Y 9 51073873 T128A T C missense Het possibly damaging 0.580 06/26/2019
28 559264 UTSW Liph 0.000 R7185 G1 225.01 Y 16 21995339 M11V T C missense Het probably benign 0.001 phenotype 06/26/2019
29 559217 UTSW Lrp1b 0.000 R7185 G1 225.01 Y 2 40801512 C T critical splice acceptor site Het probably null phenotype 06/26/2019
30 559254 UTSW Mcrip1 R7185 G1 225.01 Y 11 120544679 A C critical splice donor site 2 bp Het probably null 06/26/2019
31 559250 UTSW Myh1 0.000 R7185 G1 225.01 Y 11 67207459 E486K G A missense Het probably damaging 0.999 phenotype 06/26/2019
32 559211 UTSW Nav1 0.921 R7185 G1 225.01 Y 1 135471008 K612R T C missense Het possibly damaging 0.851 phenotype 06/26/2019
33 559261 UTSW Nek10 0.000 R7185 G1 225.01 Y 14 14846621 K245E A G missense Het probably benign 0.030 06/26/2019
34 559228 UTSW Nipal1 0.086 R7185 G1 225.01 Y 5 72666855 S181T T A missense Het probably damaging 0.983 06/26/2019
35 559258 UTSW Nme8 0.114 R7185 G1 225.01 Y 13 19677883 L192R A C missense Het probably damaging 1.000 phenotype 06/26/2019
36 559259 UTSW Nol7 0.888 R7185 G1 154.01 Y 13 43406831 G A critical splice acceptor site Het probably null phenotype 06/26/2019
37 559232 UTSW Oas1b 0.055 R7185 G1 225.01 N 5 120817772 R205H G A missense Het not run phenotype 06/26/2019
38 559219 UTSW Olfr1138 0.116 R7185 G1 225.01 Y 2 87738145 Y60H A G missense Het probably damaging 1.000 phenotype 06/26/2019
39 559220 UTSW Olfr1305 0.081 R7185 G1 225.01 Y 2 111873822 E11A T G missense Het possibly damaging 0.890 phenotype 06/26/2019
40 559223 UTSW Olfr71 0.073 R7185 G1 225.01 Y 4 43706082 I162T A G missense Het possibly damaging 0.818 phenotype 06/26/2019
41 559268 UTSW Pcdhgb6 0.140 R7185 G1 225.01 Y 18 37743648 S470P T C missense Het probably benign 0.417 0.546 phenotype 06/26/2019
42 559227 UTSW Pdzk1ip1 0.117 R7185 G1 225.01 Y 4 115089108 H55L A T missense Het possibly damaging 0.533 06/26/2019
43 559263 UTSW Pibf1 1.000 R7185 G1 225.01 Y 14 99107316 M124K T A missense Het possibly damaging 0.804 06/26/2019
44 559240 UTSW Prr36 0.124 R7185 G1 225.01 Y 8 4216458 G31R C T missense Het probably damaging 0.999 0.647 phenotype 06/26/2019
45 559266 UTSW Ptchd4 0.075 R7185 G1 225.01 Y 17 42503188 A660D C A missense Het probably damaging 1.000 06/26/2019
46 559215 UTSW Qsox2 0.149 R7185 G1 225.01 Y 2 26220706 V166A A G missense Het possibly damaging 0.633 phenotype 06/26/2019
47 559208 UTSW Rb1cc1 1.000 R7185 G1 225.01 Y 1 6238383 Y164F A T missense Het probably damaging 0.997 phenotype 06/26/2019
48 559230 UTSW Rest 1.000 R7185 G1 225.01 Y 5 77282484 H917N C A missense Het probably benign 0.000 phenotype 06/26/2019
49 559252 UTSW Rnf213 0.000 R7185 G1 225.01 Y 11 119424198 C955R T C missense Het phenotype 06/26/2019
50 559218 UTSW Scn7a 0.110 R7185 G1 225.01 Y 2 66687795 N1024I T A missense Het possibly damaging 0.815 0.179 phenotype 06/26/2019
51 559269 UTSW Sec11c 0.000 R7185 G1 225.01 Y 18 65814892 D134E T A missense Het probably damaging 1.000 06/26/2019
52 559270 UTSW Sorbs1 0.723 R7185 G1 225.01 Y 19 40376800 R180G G C missense Het probably benign 0.000 0.090 phenotype 06/26/2019
53 568570 UTSW Spo11 0.000 R7185 G1 214.01 Y 2 172982192 T A intron 100 bp Het probably null 0.976 phenotype 08/26/2019
54 559229 UTSW Srd5a3 1.000 R7185 G1 225.01 Y 5 76153572 I216T T C missense Het probably benign 0.094 phenotype 06/26/2019
55 559233 UTSW Tcaf3 0.053 R7185 G1 225.01 Y 6 42593930 N296S T C missense Het probably benign 0.006 06/26/2019
56 559253 UTSW Tepsin 0.000 R7185 G1 225.01 Y 11 120093817 D259G T C missense Het probably damaging 1.000 06/26/2019
57 559247 UTSW Themis 0.134 R7185 G1 225.01 Y 10 28781877 S300N G A missense Het probably benign 0.003 phenotype 06/26/2019
58 559242 UTSW Trhr2 0.091 R7185 G1 225.01 Y 8 122360657 T15S T A missense Het probably benign 0.264 06/26/2019
59 559255 UTSW Uts2r 0.113 R7185 G1 225.01 Y 11 121160880 V190A T C missense Het probably benign 0.127 phenotype 06/26/2019
60 559238 UTSW Vmn2r77 0.077 R7185 G1 225.01 Y 7 86801827 D307A A C missense Het probably benign 0.002 0.090 06/26/2019
61 559224 UTSW Xpa 0.000 R7185 G1 225.01 Y 4 46183078 T237K G T missense Het probably benign 0.000 phenotype 06/26/2019
62 559221 UTSW Zfp335 1.000 R7185 G1 225.01 Y 2 164893244 A G critical splice donor site 2 bp Het probably null phenotype 06/26/2019
63 559210 UTSW Zfp451 0.000 R7185 G1 225.01 Y 1 33769893 D962E A T missense Het probably damaging 1.000 06/26/2019
64 559237 UTSW Zfp60 0.000 R7185 G1 225.01 Y 7 27738405 T46A A G missense Het probably damaging 0.998 06/26/2019
65 559271 UTSW Zfy1 0.047 R7185 G1 222 Y Y 725464 S767L G A missense Het possibly damaging 0.533 06/26/2019
[records 1 to 65 of 65]