Incidental Mutations

44 incidental mutations are currently displayed, and affect 44 genes.
8 are Possibly Damaging.
17 are Probably Damaging.
14 are Probably Benign.
2 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 44 of 44] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 561531 UTSW A430033K04Rik 0.076 R7217 G1 225.01 Y 5 138646926 H358N C A missense Het probably benign 0.000 0.090 06/26/2019
2 561529 UTSW Abcg3 0.073 R7217 G1 225.01 Y 5 104939228 F543L A G missense Het possibly damaging 0.753 0.520 phenotype 06/26/2019
3 561519 UTSW Asnsd1 0.162 R7217 G1 225.01 Y 1 53348193 T92A T C missense Het probably damaging 0.998 0.252 06/26/2019
4 561562 UTSW Atg2a 0.372 R7217 G1 225.01 Y 19 6253441 G T critical splice donor site 1 bp Het probably null 0.958 06/26/2019
5 561522 UTSW Aven 0.000 R7217 G1 225.01 Y 2 112630846 N327K T A missense Het possibly damaging 0.844 phenotype 06/26/2019
6 561548 UTSW Brd9 1.000 R7217 G1 225.01 Y 13 73938944 V116A T C missense Het probably damaging 0.998 06/26/2019
7 561525 UTSW Car14 0.000 R7217 G1 225.01 Y 3 95899317 S250P A G missense Het probably damaging 1.000 phenotype 06/26/2019
8 561540 UTSW Ccdc138 0.104 R7217 G1 225.01 Y 10 58509600 I138T T C missense Het probably benign 0.333 0.062 06/26/2019
9 561549 UTSW Cmya5 0.216 R7217 G1 225.01 Y 13 93090430 Y2717H A G missense Het probably damaging 0.999 06/26/2019
10 561561 UTSW Eno1b 0.959 R7217 G1 225.01 Y 18 48047679 T308K C A missense Het probably damaging 0.973 0.647 phenotype 06/26/2019
11 561555 UTSW Epha3 0.337 R7217 G1 225.01 Y 16 63552494 T949A T C missense Het probably benign 0.003 0.069 phenotype 06/26/2019
12 561524 UTSW Fcrl5 0.058 R7217 G1 225.01 Y 3 87443774 T197M C T missense Het probably damaging 0.998 phenotype 06/26/2019
13 561532 UTSW Foxp2 1.000 R7217 G1 225.01 Y 6 15416024 Q664L A T missense Het unknown 0.080 phenotype 06/26/2019
14 561521 UTSW Fsip2 0.104 R7217 G1 225.01 Y 2 82989068 K5048N A T missense Het possibly damaging 0.847 phenotype 06/26/2019
15 561550 UTSW Gcnt4 0.111 R7217 G1 225.01 Y 13 96946310 L38P T C missense Het probably damaging 0.982 phenotype 06/26/2019
16 561556 UTSW Gm11127 0.054 R7217 G1 225.01 Y 17 36056343 M329R A C missense Het probably benign 0.015 0.090 06/26/2019
17 561545 UTSW Gpr68 0.000 R7217 G1 225.01 Y 12 100878799 V162A A G missense Het possibly damaging 0.910 0.072 phenotype 06/26/2019
18 561526 UTSW Grin3a 0.000 R7217 G1 225.01 Y 4 49770741 M677K A T missense Het possibly damaging 0.806 0.590 phenotype 06/26/2019
19 561533 UTSW Grm7 0.000 R7217 G1 225.01 Y 6 111358824 Y732C A G missense Het probably damaging 1.000 0.745 phenotype 06/26/2019
20 561542 UTSW Hoxb4 0.828 R7217 G1 225.01 N 11 96319080 E104G A G missense Het probably benign 0.019 phenotype 06/26/2019
21 561541 UTSW Kat7 1.000 R7217 G1 225.01 Y 11 95291564 S237P A G missense Het possibly damaging 0.794 phenotype 06/26/2019
22 561552 UTSW Kif13b 0.000 R7217 G1 221.01 Y 14 64773068 V1272A T C missense Het probably damaging 1.000 phenotype 06/26/2019
23 561560 UTSW Kif20a 1.000 R7217 G1 225.01 Y 18 34629560 H495Q T A missense Het probably benign 0.137 0.067 06/26/2019
24 561558 UTSW Lama1 1.000 R7217 G1 225.01 Y 17 67764673 T852S A T missense Het 0.087 phenotype 06/26/2019
25 561559 UTSW Mep1b 0.185 R7217 G1 225.01 Y 18 21093543 D487E T A missense Het probably benign 0.012 0.087 phenotype 06/26/2019
26 561536 UTSW Mki67 0.741 R7217 G1 225.01 Y 7 135704182 T656A T C missense Het probably damaging 0.999 0.348 phenotype 06/26/2019
27 561544 UTSW Mlh3 0.000 R7217 G1 225.01 Y 12 85266707 W902R A G missense Het probably benign 0.000 0.090 phenotype 06/26/2019
28 561538 UTSW Muc16 0.136 R7217 G1 225.01 Y 9 18644076 Y3640* A T nonsense Het probably null 0.976 phenotype 06/26/2019
29 561523 UTSW Ogfr 0.599 R7217 G1 213.46 N 2 180595266 GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG unclassified Het probably benign phenotype 06/26/2019
30 561537 UTSW Pkd1l2 0.000 R7217 G1 225.01 Y 8 116995797 I2424T A G missense Het probably benign 0.243 phenotype 06/26/2019
31 561546 UTSW Prl8a2 0.065 R7217 G1 225.01 Y 13 27351015 E91G A G missense Het possibly damaging 0.893 phenotype 06/26/2019
32 561520 UTSW Prpf18 1.000 R7217 G1 225.01 Y 2 4645624 V65A A G missense Het probably benign 0.010 0.068 phenotype 06/26/2019
33 561530 UTSW Pxmp2 0.139 R7217 G1 225.01 Y 5 110285905 V34A A G missense Het probably damaging 0.988 0.209 phenotype 06/26/2019
34 561539 UTSW Ranbp2 1.000 R7217 G1 225.01 Y 10 58452017 Y36D T G missense Het probably damaging 1.000 0.693 phenotype 06/26/2019
35 561543 UTSW Rbm25 1.000 R7217 G1 225.01 Y 12 83664217 R368Q G A missense Het unknown 0.087 06/26/2019
36 561553 UTSW Rims2 0.480 R7217 G1 225.01 Y 15 39476489 L860M C A missense Het probably damaging 0.994 0.647 phenotype 06/26/2019
37 561535 UTSW Rsf1 1.000 R7217 G1 217.47 N 7 97579932 CGGC CGGCGGCGGGGGC unclassified Het probably benign phenotype 06/26/2019
38 561554 UTSW Scn8a 0.756 R7217 G1 225.01 Y 15 100970227 M318L A T missense Het probably benign 0.001 0.090 phenotype 06/26/2019
39 561557 UTSW Slc35b2 0.179 R7217 G1 225.01 Y 17 45565029 T55A A G missense Het probably benign 0.190 phenotype 06/26/2019
40 561527 UTSW Trnp1 R7217 G1 225.01 N 4 133498105 E118G T C missense Het possibly damaging 0.816 06/26/2019
41 561534 UTSW Ttll13 0.227 R7217 G1 225.01 Y 7 80254163 K280Q A C missense Het probably damaging 1.000 0.189 06/26/2019
42 561528 UTSW Wdfy3 0.930 R7217 G1 225.01 Y 5 101901919 H1680Q A T missense Het probably damaging 0.999 0.236 phenotype 06/26/2019
43 561551 UTSW Zfp131 0.957 R7217 G1 225.01 Y 13 119775841 I327T A G missense Het probably damaging 0.994 0.315 phenotype 06/26/2019
44 561547 UTSW Zfp729b 0.107 R7217 G1 225.01 Y 13 67595248 V66A A G missense Het probably damaging 0.962 06/26/2019
[records 1 to 44 of 44]