Incidental Mutations

79 incidental mutations are currently displayed, and affect 79 genes.
14 are Possibly Damaging.
31 are Probably Damaging.
25 are Probably Benign.
7 are Probably Null.
4 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 79 of 79] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 561801 UTSW 5330417C22Rik 0.092 R7221 G1 225.01 Y 3 108475001 D232A T G missense Het possibly damaging 0.916 phenotype 06/26/2019
2 561832 UTSW Abr 0.470 R7221 G1 225.01 Y 11 76423161 M720R A C missense Het probably benign 0.086 phenotype 06/26/2019
3 561809 UTSW Acad10 0.000 R7221 G1 225.01 Y 5 121630210 T761M G A missense Het probably damaging 1.000 phenotype 06/26/2019
4 561783 UTSW Agxt 0.090 R7221 G1 225.01 Y 1 93137901 G164V G T missense Het possibly damaging 0.771 phenotype 06/26/2019
5 561782 UTSW Ankar 0.073 R7221 G1 225.01 Y 1 72650231 G1247D C T missense Het probably damaging 0.999 06/26/2019
6 561838 UTSW Bptf 1.000 R7221 G1 225.01 Y 11 107054832 L2527R A C missense Het probably damaging 0.998 0.200 phenotype 06/26/2019
7 561785 UTSW Brinp2 0.165 R7221 G1 225.01 Y 1 158266547 H195R T C missense Het possibly damaging 0.900 06/26/2019
8 561796 UTSW C130079G13Rik 0.090 R7221 G1 202.01 Y 3 59928933 A G start gained Het probably benign 0.112 06/26/2019
9 561812 UTSW Cacna2d4 0.000 R7221 G1 225.01 Y 6 119236663 R14S G T missense Het probably benign 0.024 phenotype 06/26/2019
10 561819 UTSW Cep126 0.000 R7221 G1 225.01 Y 9 8100987 C515* A T nonsense Het probably null 06/26/2019
11 561800 UTSW Chia1 0.492 R7221 G1 225.01 Y 3 106131920 N442I A T missense Het probably damaging 0.996 phenotype 06/26/2019
12 561826 UTSW Clasp2 0.000 R7221 G1 225.01 Y 9 113852757 D327G A G missense Het probably damaging 0.988 phenotype 06/26/2019
13 561793 UTSW Cnbd2 0.070 R7221 G1 225.01 Y 2 156373661 F519L T C missense Het probably benign 0.009 0.072 phenotype 06/26/2019
14 561786 UTSW Cntrl 0.893 R7221 G1 225.01 Y 2 35151857 F1214I T A missense Het possibly damaging 0.463 phenotype 06/26/2019
15 561855 UTSW Cul9 0.352 R7221 G1 225.01 Y 17 46528565 M829K A T missense Het probably damaging 0.993 phenotype 06/26/2019
16 561805 UTSW Cyp4b1 0.000 R7221 G1 225.01 Y 4 115635978 Q223R T C missense Het possibly damaging 0.916 0.140 phenotype 06/26/2019
17 561816 UTSW Defb37 0.077 R7221 G1 225.01 Y 8 18990972 M1K A T start codon destroyed Het probably null 06/26/2019
18 561781 UTSW Dnah7c 0.222 R7221 G1 225.01 Y 1 46455777 Q55L A T missense Het possibly damaging 0.873 06/26/2019
19 561807 UTSW Eif2b4 1.000 R7221 G1 225.01 Y 5 31187787 D463E A T missense Het possibly damaging 0.554 0.086 phenotype 06/26/2019
20 561806 UTSW Elovl1 1.000 R7221 G1 225.01 Y 4 118431614 H167Y C T missense Het probably damaging 0.999 0.137 phenotype 06/26/2019
21 561841 UTSW Emb 0.120 R7221 G1 225.01 Y 13 117267477 L255Q T A missense Het probably damaging 1.000 phenotype 06/26/2019
22 561811 UTSW Eogt 0.248 R7221 G1 225.01 Y 6 97112724 Y465C T C missense Het probably damaging 1.000 phenotype 06/26/2019
23 561842 UTSW Erc2 0.000 R7221 G1 225.01 Y 14 27653158 H111R A G missense Het probably damaging 0.969 phenotype 06/26/2019
24 561813 UTSW Fam234b 0.079 R7221 G1 225.01 Y 6 135228531 F498S T C missense Het probably damaging 1.000 06/26/2019
25 561808 UTSW Fgfr3 0.407 R7221 G1 217.47 Y 5 33732748 GAGGCTGGCAGCGTGTACGCAGGC GAGGC frame shift Het probably null 0.976 phenotype 06/26/2019
26 561792 UTSW Flrt3 1.000 R7221 G1 225.01 Y 2 140661170 E179D T A missense Het probably damaging 0.994 phenotype 06/26/2019
27 561846 UTSW Fndc3a 0.518 R7221 G1 225.01 Y 14 72556157 R993G T C missense Het probably benign 0.000 phenotype 06/26/2019
28 561836 UTSW Gm11639 0.114 R7221 G1 225.01 Y 11 104900606 N2882S A G missense Het probably benign 0.359 0.090 06/26/2019
29 561789 UTSW Gm13762 0.066 R7221 G1 225.01 Y 2 88973153 V246A A G missense Het probably damaging 0.989 06/26/2019
30 561795 UTSW Gm14325 0.224 R7221 G1 194.01 Y 2 177834610 T14A T C missense Het probably damaging 1.000 06/26/2019
31 561845 UTSW Gm5464 R7221 G1 225.01 Y 14 66869232 V106D T A missense Het unknown 06/26/2019
32 561817 UTSW Gm7697 R7221 G1 225.01 N 8 69522664 D50A T G missense Het probably benign 0.082 06/26/2019
33 561856 UTSW Gpatch11 0.115 R7221 G1 225.01 Y 17 78842117 I182N T A missense Het possibly damaging 0.691 06/26/2019
34 561830 UTSW Grm6 0.000 R7221 G1 225.01 Y 11 50863043 R725G A G missense Het probably damaging 0.969 phenotype 06/26/2019
35 561835 UTSW Hap1 0.643 R7221 G1 225.01 Y 11 100348829 M588K A T missense Het probably benign 0.018 0.090 phenotype 06/26/2019
36 561837 UTSW Icam2 0.000 R7221 G1 225.01 Y 11 106382442 F15L A G missense Het probably benign 0.011 0.090 phenotype 06/26/2019
37 561803 UTSW Ints8 0.962 R7221 G1 225.01 Y 4 11225613 M648T A G missense Het probably benign 0.010 phenotype 06/26/2019
38 561840 UTSW Ipo11 1.000 R7221 G1 225.01 Y 13 106892557 L296Q A T missense Het probably damaging 1.000 phenotype 06/26/2019
39 561797 UTSW Kirrel 1.000 R7221 G1 225.01 Y 3 87086397 Q518* G A nonsense Het probably null phenotype 06/26/2019
40 561849 UTSW Krt18 0.000 R7221 G1 225.01 Y 15 102029532 D155Y G T missense Het possibly damaging 0.660 phenotype 06/26/2019
41 561823 UTSW Lctl 0.108 R7221 G1 225.01 Y 9 64118935 K91* A T nonsense Het probably null 0.975 phenotype 06/26/2019
42 561851 UTSW Marf1 0.241 R7221 G1 225.01 Y 16 14142485 R565L C A missense Het probably damaging 1.000 phenotype 06/26/2019
43 561834 UTSW Med13 0.947 R7221 G1 225.01 Y 11 86288095 D1458E A T missense Het probably benign 0.001 phenotype 06/26/2019
44 561794 UTSW Mroh8 0.939 R7221 G1 225.01 Y 2 157229917 Y556F T A missense Het probably benign 0.056 0.078 phenotype 06/26/2019
45 561820 UTSW Muc16 0.234 R7221 G1 225.01 Y 9 18642199 G4266D C T missense Het probably benign 0.044 phenotype 06/26/2019
46 561833 UTSW Nsrp1 1.000 R7221 G1 225.01 Y 11 77048423 F182I A T missense Het probably damaging 1.000 phenotype 06/26/2019
47 561814 UTSW Obox3 0.211 R7221 G1 225.01 Y 7 15626058 Y229N A T missense Het probably benign 0.015 06/26/2019
48 561788 UTSW Olfr1184 0.075 R7221 G1 225.01 Y 2 88487629 V299D T A missense Het probably damaging 0.971 phenotype 06/26/2019
49 561854 UTSW Olfr124 0.065 R7221 G1 225.01 Y 17 37805561 K139E A G missense Het probably benign 0.035 phenotype 06/26/2019
50 561790 UTSW Olfr1247 0.080 R7221 G1 225.01 Y 2 89609928 Y58C T C missense Het probably damaging 1.000 phenotype 06/26/2019
51 561839 UTSW Olfr1359 0.296 R7221 G1 225.01 Y 13 21703102 S34P T C missense Het probably damaging 0.997 phenotype 06/26/2019
52 561821 UTSW Olfr26 0.074 R7221 G1 225.01 Y 9 38855242 Y60C A G missense Het probably damaging 1.000 phenotype 06/26/2019
53 561843 UTSW Olfr746 0.132 R7221 G1 225.01 Y 14 50654071 Y278F A T missense Het probably damaging 0.993 phenotype 06/26/2019
54 561858 UTSW Pabpc2 0.146 R7221 G1 225.01 Y 18 39773910 V76D T A missense Het possibly damaging 0.522 06/26/2019
55 561852 UTSW Parp9 0.193 R7221 G1 225.01 Y 16 35953701 W348R T C missense Het probably benign 0.004 0.090 06/26/2019
56 561804 UTSW Pdp1 0.000 R7221 G1 225.01 Y 4 11961004 T455A T C missense Het probably damaging 0.989 phenotype 06/26/2019
57 561827 UTSW Phactr2 0.000 R7221 G1 225.01 Y 10 13247039 D446E A C missense Het possibly damaging 0.580 06/26/2019
58 561799 UTSW Pi4kb 0.963 R7221 G1 225.01 Y 3 94994189 L389P T C missense Het probably damaging 0.998 06/26/2019
59 561791 UTSW Pla2g4f 0.072 R7221 G1 225.01 Y 2 120300995 R749H C T missense Het probably benign 0.065 06/26/2019
60 561848 UTSW Plec 0.913 R7221 G1 142.01 Y 15 76175774 V3321A A G missense Het probably damaging 0.974 phenotype 06/26/2019
61 561825 UTSW Plod2 1.000 R7221 G1 225.01 Y 9 92584527 V180A T C missense Het probably damaging 0.999 0.292 phenotype 06/26/2019
62 561802 UTSW Plppr5 0.077 R7221 G1 225.01 Y 3 117620969 I80V A G missense Het probably damaging 0.998 phenotype 06/26/2019
63 568639 UTSW Rubcn 0.933 R7221 G1 97.01 Y 16 32866923 T C intron 1170 bp Het probably null 0.976 phenotype 09/05/2019
64 561844 UTSW Sacs 0.000 R7221 G1 225.01 Y 14 61208806 V2767A T C missense Het probably damaging 0.992 phenotype 06/26/2019
65 561798 UTSW Selenbp2 0.419 R7221 G1 225.01 Y 3 94703826 Y414* C G nonsense Het probably null 06/26/2019
66 561847 UTSW Slc45a4 0.000 R7221 G1 225.01 Y 15 73586410 M430K A T missense Het probably benign 0.064 06/26/2019
67 561815 UTSW Smg1 1.000 R7221 G1 225.01 Y 7 118182797 L1145P A G missense Het possibly damaging 0.856 phenotype 06/26/2019
68 561831 UTSW Spns2 0.000 R7221 G1 225.01 Y 11 72456916 V316A A G missense Het probably benign 0.426 phenotype 06/26/2019
69 561850 UTSW Srl 0.095 R7221 G1 225.01 Y 16 4482947 E753D T A missense Het probably damaging 0.994 phenotype 06/26/2019
70 561857 UTSW Thada 0.000 R7221 G1 225.01 Y 17 84464366 T23A T C missense Het possibly damaging 0.462 phenotype 06/26/2019
71 561818 UTSW Tmem231 1.000 R7221 G1 190.01 Y 8 111933676 T31A T C missense Het probably benign 0.000 0.090 phenotype 06/26/2019
72 561784 UTSW Tpr 1.000 R7221 G1 225.01 Y 1 150446178 T2321M C T missense Het possibly damaging 0.956 phenotype 06/26/2019
73 561787 UTSW Ttn 1.000 R7221 G1 225.01 Y 2 76941851 N2615I T A missense Het unknown phenotype 06/26/2019
74 561810 UTSW Vmn1r41 0.058 R7221 G1 111.01 N 6 89747052 I192V A G missense Het probably benign 0.005 06/26/2019
75 561829 UTSW Vmn2r83 0.076 R7221 G1 225.01 Y 10 79480167 T466S A T missense Het probably benign 0.019 06/26/2019
76 561828 UTSW Vnn1 0.126 R7221 G1 225.01 Y 10 23895054 D60G A G missense Het probably benign 0.070 phenotype 06/26/2019
77 561853 UTSW Wiz 1.000 R7221 G1 225.01 Y 17 32359165 P449S G A missense Het probably benign 0.026 phenotype 06/26/2019
78 561824 UTSW Zic1 0.940 R7221 G1 225.01 Y 9 91364732 S96P A G missense Het probably damaging 1.000 0.076 phenotype 06/26/2019
79 561822 UTSW Zw10 0.967 R7221 G1 225.01 Y 9 49069712 S471T T A missense Het probably benign 0.004 0.071 phenotype 06/26/2019
[records 1 to 79 of 79]