Incidental Mutations

80 incidental mutations are currently displayed, and affect 80 genes.
12 are Possibly Damaging.
26 are Probably Damaging.
27 are Probably Benign.
8 are Probably Null.
2 create premature stop codons.
3 are critical splice junction mutations.
Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 80 of 80] per page Full List
 
 ID question?
 Source question?
 Gene question?
 E-score question?
  		Stock # question?
 Gen question?
 Quality
- 		Vld question?
 Strain question?
 Chr question?
 Position question?
 		 Mutation question?
 Ref
 Var
 Type question?
 Exon Dist question?
  		Zygosity question?
 Predicted Effect question?
 PPH Score question?
- 		Meta Score question?
  		MGI Phenotype question?
 Posted question?
 
1 562031 UTSW 4930432K21Rik 0.069 R7224 G1 225.01 Y 8 84172213 (GRCm38) T577A A G missense Het probably benign 0.000 2019-06-26
2 562002 UTSW Aadac 0.000 R7224 G1 225.01 Y 3 60035854 (GRCm38) T60M C T missense Het probably benign 0.134 phenotype 2019-06-26
3 562023 UTSW Actn4 0.841 R7224 G1 225.01 Y 7 28962084 (GRCm38) A34T C T missense Het probably benign 0.079 phenotype 2019-06-26
4 562063 UTSW Acvrl1 1.000 R7224 G1 225.01 Y 15 101143364 (GRCm38) M466V A G missense Het probably benign 0.168 phenotype 2019-06-26
5 562037 UTSW Adamts7 0.090 R7224 G1 225.01 Y 9 90185815 (GRCm38) Y453H T C missense Het probably damaging 1.000 0.483 phenotype 2019-06-26
6 562032 UTSW Amfr 0.000 R7224 G1 225.01 Y 8 93984856 (GRCm38) P351S G A missense Het probably damaging 1.000 phenotype 2019-06-26
7 562021 UTSW Ankrd26 0.000 R7224 G1 225.01 Y 6 118539727 (GRCm38) T492M G A missense Het probably benign 0.069 phenotype 2019-06-26
8 562047 UTSW Anxa6 0.111 R7224 G1 225.01 Y 11 54986167 (GRCm38) F547L A G missense Het probably damaging 0.999 phenotype 2019-06-26
9 562057 UTSW Ap5m1 0.000 R7224 G1 225.01 Y 14 49080927 (GRCm38) Y394D T G missense Het unknown 2019-06-26
10 561994 UTSW Atic 0.966 R7224 G1 225.01 Y 1 71570855 (GRCm38) V342I G A missense Het probably benign 0.000 phenotype 2019-06-26
11 562053 UTSW Atl1 0.454 R7224 G1 225.01 Y 12 69955353 (GRCm38) T362N C A missense Het probably benign 0.000 0.058 phenotype 2019-06-26
12 562025 UTSW Atp10a 0.095 R7224 G1 225.01 Y 7 58797471 (GRCm38) M654L A T missense Het probably benign 0.005 p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators] (source: MGI)">phenotype 2019-06-26
13 562064 UTSW B3gnt5 0.501 R7224 G1 225.01 Y 16 19769753 (GRCm38) M241L A T missense Het probably benign 0.060 phenotype 2019-06-26
14 562001 UTSW Bbs7 0.000 R7224 G1 225.01 Y 3 36605728 (GRCm38) V186A A G missense Het possibly damaging 0.480 phenotype 2019-06-26
15 562010 UTSW C8b 0.000 R7224 G1 225.01 Y 4 104780598 (GRCm38) L89P T C missense Het probably damaging 0.997 0.300 phenotype 2019-06-26
16 562056 UTSW Capn7 0.820 R7224 G1 225.01 Y 14 31370721 (GRCm38) E742* G T nonsense Het probably null phenotype 2019-06-26
17 562041 UTSW Ccdc162 0.081 R7224 G1 225.01 Y 10 41561191 (GRCm38) R1741C G A missense Het probably damaging 1.000 0.647 2019-06-26
18 562067 UTSW Chsy3 0.000 R7224 G1 225.01 Y 18 59408975 (GRCm38) L395H T A missense Het probably damaging 1.000 phenotype 2019-06-26
19 561995 UTSW Cnot9 1.000 R7224 G1 225.01 Y 1 74517229 (GRCm38) T62A A G missense Het probably benign 0.164 phenotype 2019-06-26
20 562024 UTSW Cyfip1 1.000 R7224 G1 217.47 Y 7 55928189 (GRCm38) AGTGT AGT frame shift Het probably null phenotype 2019-06-26
21 574580 UTSW Cyp2d12 0.150 R7224 G1 225.01 Y 15 82557648 (GRCm38) T A splice site Het probably null 2019-09-18
22 561993 UTSW Dnah7a 0.122 R7224 G1 225.01 Y 1 53397261 (GRCm38) V3974A A G missense Het probably benign 0.001 2019-06-26
23 562054 UTSW Dync1h1 1.000 R7224 G1 225.01 Y 12 110617762 (GRCm38) G533D G A missense Het possibly damaging 0.926 0.179 phenotype 2019-06-26
24 562016 UTSW Elfn1 0.146 R7224 G1 225.01 Y 5 139972473 (GRCm38) S411G A G missense Het probably benign 0.005 phenotype 2019-06-26
25 562039 UTSW Enpp3 0.131 R7224 G1 225.01 Y 10 24776884 (GRCm38) D725G T C missense Het possibly damaging 0.633 phenotype 2019-06-26
26 562022 UTSW Epp13 0.061 R7224 G1 217.01 Y 7 6268802 (GRCm38) M77R T G missense Het probably benign 0.092 0.090 2019-06-26
27 562050 UTSW Fmnl1 0.143 R7224 G1 225.01 Y 11 103182769 (GRCm38) T C critical splice donor site 2 bp Het probably null phenotype 2019-06-26
28 562048 UTSW Fndc8 0.057 R7224 G1 225.01 Y 11 82892325 (GRCm38) M44T T C missense Het probably benign 0.048 0.090 2019-06-26
29 562051 UTSW Gcgr 0.000 R7224 G1 202.01 Y 11 120534712 (GRCm38) A T start gained Het probably benign phenotype 2019-06-26
30 562042 UTSW Ggt1 0.111 R7224 G1 225.01 Y 10 75574276 (GRCm38) V14D T A missense Het possibly damaging 0.861 phenotype 2019-06-26
31 561996 UTSW Gigyf2 0.934 R7224 G1 225.01 Y 1 87403725 (GRCm38) I198M A G missense Het unknown phenotype 2019-06-26
32 562013 UTSW Gm28710 0.211 R7224 G1 225.01 Y 5 16836594 (GRCm38) V615A T C missense Het possibly damaging 0.922 2019-06-26
33 562030 UTSW Gm40460 R7224 G1 188.46 N 7 142240434 (GRCm38) GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG small deletion Het probably benign 2019-06-26
34 562066 UTSW Gm6034 0.061 R7224 G1 225.01 Y 17 36056439 (GRCm38) S59T T A missense Het unknown 0.087 2019-06-26
35 562017 UTSW Gm6408 0.088 R7224 G1 225.01 N 5 146484370 (GRCm38) V270I G A missense Het probably benign 0.099 2019-06-26
36 562011 UTSW Gm853 0.101 R7224 G1 225.01 Y 4 130219199 (GRCm38) A135P C G missense Het probably damaging 1.000 0.633 2019-06-26
37 562061 UTSW Gpr20 0.000 R7224 G1 225.01 Y 15 73696132 (GRCm38) I136N A T missense Het probably damaging 0.999 0.458 2019-06-26
38 562070 UTSW Ide 0.000 R7224 G1 225.01 Y 19 37290761 (GRCm38) E565G T C missense Het phenotype 2019-06-26
39 561997 UTSW Igsf9 0.000 R7224 G1 225.01 Y 1 172494782 (GRCm38) S515P T C missense Het probably damaging 0.999 phenotype 2019-06-26
40 562019 UTSW Kbtbd12 0.130 R7224 G1 225.01 Y 6 88613983 (GRCm38) R416* G A nonsense Het probably null 2019-06-26
41 562006 UTSW Kcnd3 0.000 R7224 G1 225.01 Y 3 105669084 (GRCm38) I615F A T missense Het probably damaging 0.983 0.255 phenotype 2019-06-26
42 562068 UTSW Kcnk7 0.000 R7224 G1 225.01 Y 19 5706777 (GRCm38) M265L A T missense Het probably benign 0.000 phenotype 2019-06-26
43 562052 UTSW Klhdc1 0.000 R7224 G1 225.01 Y 12 69263149 (GRCm38) S275N G A missense Het probably damaging 0.999 0.086 2019-06-26
44 562003 UTSW Lrba 0.000 R7224 G1 225.01 Y 3 86395246 (GRCm38) N1871T A C missense Het probably damaging 0.999 phenotype 2019-06-26
45 562027 UTSW Lrrk1 1.000 R7224 G1 225.01 Y 7 66332386 (GRCm38) V169A A G missense Het probably damaging 0.989 phenotype 2019-06-26
46 562020 UTSW Magi1 0.538 R7224 G1 225.01 Y 6 93683089 (GRCm38) I1175T A G missense Het probably benign 0.337 phenotype 2019-06-26
47 562004 UTSW Man1a2 1.000 R7224 G1 225.01 Y 3 100582053 (GRCm38) T537A T C missense Het possibly damaging 0.852 0.139 phenotype 2019-06-26
48 562029 UTSW Mrpl17 0.952 R7224 G1 225.01 Y 7 105810002 (GRCm38) N129S T C missense Het probably damaging 0.986 phenotype 2019-06-26
49 562008 UTSW Mup5 0.193 R7224 G1 225.01 Y 4 61832385 (GRCm38) R174C G A missense Het probably damaging 0.995 2019-06-26
50 561999 UTSW Ndufaf1 0.344 R7224 G1 225.01 Y 2 119658396 (GRCm38) R216C G A missense Het probably damaging 1.000 phenotype 2019-06-26
51 574577 UTSW Neb 0.847 R7224 G1 46.01 Y 2 52334659 (GRCm38) T C splice site Het probably null phenotype 2019-09-18
52 562005 UTSW Olfml3 0.000 R7224 G1 225.01 Y 3 103735860 (GRCm38) K402E T C missense Het probably damaging 0.993 0.186 phenotype 2019-06-26
53 562028 UTSW Olfr553 0.077 R7224 G1 225.01 Y 7 102614767 (GRCm38) M74K A T missense Het probably damaging 0.999 phenotype 2019-06-26
54 562069 UTSW Olfr76 0.190 R7224 G1 225.01 Y 19 12120548 (GRCm38) T55A T C missense Het probably benign 0.001 phenotype 2019-06-26
55 562034 UTSW Olfr875 0.089 R7224 G1 225.01 Y 9 37773415 (GRCm38) G252D G A missense Het possibly damaging 0.955 phenotype 2019-06-26
56 562044 UTSW Osbpl8 0.151 R7224 G1 225.01 Y 10 111275011 (GRCm38) P458L C T missense Het possibly damaging 0.936 0.341 phenotype 2019-06-26
57 562060 UTSW Pcdh20 0.000 R7224 G1 225.01 Y 14 88469075 (GRCm38) E263G T C missense Het possibly damaging 0.851 phenotype 2019-06-26
58 562046 UTSW Pkd1l1 1.000 R7224 G1 225.01 Y 11 8945241 (GRCm38) L623P A G missense Het phenotype 2019-06-26
59 562049 UTSW Plxdc1 0.150 R7224 G1 225.01 Y 11 97932327 (GRCm38) T363A T C missense Het possibly damaging 0.877 2019-06-26
60 562009 UTSW Pole3 0.935 R7224 G1 225.01 Y 4 62524050 (GRCm38) D111G T C missense Het unknown 0.061 phenotype 2019-06-26
61 562045 UTSW R3hdm2 0.532 R7224 G1 225.01 Y 10 127458153 (GRCm38) L172Q T A missense Het probably damaging 1.000 2019-06-26
62 562014 UTSW Rbm33 1.000 R7224 G1 225.01 Y 5 28394324 (GRCm38) V90A T C missense Het 2019-06-26
63 562058 UTSW Rcbtb1 0.346 R7224 G1 225.01 Y 14 59228379 (GRCm38) I390M C G missense Het probably damaging 0.999 phenotype 2019-06-26
64 562000 UTSW Romo1 R7224 G1 225.01 Y 2 156144375 (GRCm38) G A unclassified Het probably benign phenotype 2019-06-26
65 562007 UTSW Sars 1.000 R7224 G1 225.01 Y 3 108428203 (GRCm38) Y410H A G missense Het probably damaging 0.997 0.770 phenotype 2019-06-26
66 562012 UTSW Sesn2 0.291 R7224 G1 225.01 Y 4 132497413 (GRCm38) T327A T C missense Het probably benign 0.223 phenotype 2019-06-26
67 562055 UTSW Slc30a5 0.484 R7224 G1 225.01 Y 13 100809254 (GRCm38) V530A A G missense Het probably damaging 0.994 0.558 phenotype 2019-06-26
68 562015 UTSW Slc30a9 0.929 R7224 G1 225.01 Y 5 67315701 (GRCm38) E43K G A missense Het probably benign 0.000 0.090 2019-06-26
69 562062 UTSW Slc38a2 0.269 R7224 G1 225.01 Y 15 96691359 (GRCm38) L418W A C missense Het probably damaging 1.000 2019-06-26
70 562036 UTSW Snx14 1.000 R7224 G1 225.01 Y 9 88394561 (GRCm38) E557G T C missense Het possibly damaging 0.922 0.260 phenotype 2019-06-26
71 562033 UTSW Spata33 0.062 R7224 G1 225.01 Y 8 123221998 (GRCm38) I123K T A missense Het probably damaging 0.962 0.647 2019-06-26
72 562059 UTSW Tdrd3 0.335 R7224 G1 225.01 Y 14 87477403 (GRCm38) H170L A T missense Het probably damaging 1.000 phenotype 2019-06-26
73 562026 UTSW Trpm1 0.000 R7224 G1 225.01 Y 7 64219106 (GRCm38) A G critical splice acceptor site Het probably null phenotype 2019-06-26
74 562065 UTSW Tsr3 0.171 R7224 G1 225.01 Y 17 25242595 (GRCm38) E302D A T missense Het probably benign 0.009 2019-06-26
75 561998 UTSW Ttll11 0.000 R7224 G1 225.01 Y 2 35902673 (GRCm38) I386T A G missense Het probably damaging 1.000 2019-06-26
76 562035 UTSW Usp2 0.000 R7224 G1 225.01 Y 9 44075969 (GRCm38) T188M C T missense Het possibly damaging 0.950 phenotype 2019-06-26
77 562043 UTSW Usp44 0.000 R7224 G1 225.01 Y 10 93845993 (GRCm38) I102V A G missense Het probably benign 0.075 0.067 phenotype 2019-06-26
78 562040 UTSW Wasf1 0.457 R7224 G1 225.01 Y 10 40926550 (GRCm38) N67S A G missense Het probably benign 0.165 phenotype 2019-06-26
79 562038 UTSW Zfp445 0.559 R7224 G1 225.01 Y 9 122852143 (GRCm38) N911S T C missense Het probably benign 0.278 2019-06-26
80 562018 UTSW Zfp467 0.249 R7224 G1 225.01 Y 6 48444969 (GRCm38) A G critical splice donor site 2 bp Het probably null phenotype 2019-06-26
[records 1 to 80 of 80]