Incidental Mutations

107 incidental mutations are currently displayed, and affect 105 genes.
19 are Possibly Damaging.
33 are Probably Damaging.
35 are Probably Benign.
9 are Probably Null.
4 create premature stop codons.
3 are critical splice junction mutations.
Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 107] next >> last >| per page Full List
 
 ID question?
 Source question?
 Gene question?
 E-score question?
  		Stock # question?
 Gen question?
 Quality
- 		Vld question?
 Strain question?
 Chr question?
 Position question?
 		 Mutation question?
 Ref
 Var
 Type question?
 Exon Dist question?
  		Zygosity question?
 Predicted Effect question?
 PPH Score question?
- 		Meta Score question?
  		MGI Phenotype question?
 Posted question?
 
1 562958 UTSW 1110002E22Rik 0.391 R7238 G1 225.01 Y 3 138069951 T1634S A T missense Het probably damaging 0.998 06/26/2019
2 562953 UTSW 4930402H24Rik 0.000 R7238 G1 225.01 Y 2 130806788 R258L C A missense Het unknown 0.087 phenotype 06/26/2019
3 562963 UTSW 4933402N22Rik R7238 G1 191.01 N 5 11920745 I127T T C missense Het 06/26/2019
4 562966 UTSW 5830473C10Rik 0.054 R7238 G1 225.01 Y 5 90579660 Y379F A T missense Het probably damaging 0.998 0.647 06/26/2019
5 562995 UTSW Adgrl1 0.000 R7238 G1 225.01 Y 8 83939064 M1460K T A missense Het probably damaging 0.994 phenotype 06/26/2019
6 562955 UTSW Adig 0.000 R7238 G1 225.01 Y 2 158505853 L29Q T A missense Het unknown 0.087 06/26/2019
7 562956 UTSW Adnp 1.000 R7238 G1 225.01 Y 2 168183967 K469N T G missense Het probably damaging 0.997 phenotype 06/26/2019
8 562980 UTSW Akap3 0.075 R7238 G1 225.01 Y 6 126865237 D273G A G missense Het probably benign 0.002 0.090 phenotype 06/26/2019
9 563026 UTSW Ankrd34b 0.056 R7238 G1 225.01 Y 13 92438631 Y124H T C missense Het possibly damaging 0.772 06/26/2019
10 563015 UTSW Ap2b1 1.000 R7238 G1 225.01 Y 11 83333122 F221C T G missense Het possibly damaging 0.908 0.277 phenotype 06/26/2019
11 562998 UTSW Atp2c2 0.000 R7238 G1 225.01 Y 8 119742421 I358V A G missense Het possibly damaging 0.731 06/26/2019
12 563024 UTSW BC051665 0.161 R7238 G1 225.01 Y 13 60782722 T272I G A missense Het probably benign 0.301 06/26/2019
13 563033 UTSW BC117090 0.074 R7238 G1 225.01 Y 16 36321831 G61D C T missense Het probably benign 0.289 06/26/2019
14 562952 UTSW Cdan1 1.000 R7238 G1 225.01 Y 2 120730302 A262E G T missense Het probably benign 0.000 phenotype 06/26/2019
15 562996 UTSW Ces1d 0.000 R7238 G1 225.01 Y 8 93178135 V326I C T missense Het probably benign 0.014 phenotype 06/26/2019
16 563008 UTSW Chd3 0.000 R7238 G1 225.01 Y 11 69364047 R156G T C missense Het probably benign 0.312 0.072 phenotype 06/26/2019
17 562969 UTSW Clip1 0.000 R7238 G1 225.01 Y 5 123613265 E818K C T missense Het phenotype 06/26/2019
18 563003 UTSW Col6a4 0.000 R7238 G1 225.01 Y 9 106000320 V2153M C T missense Het probably damaging 0.990 06/26/2019
19 563014 UTSW Crlf3 0.000 R7238 G1 225.01 Y 11 80056525 N296D T C missense Het possibly damaging 0.942 0.083 phenotype 06/26/2019
20 563006 UTSW D130052B06Rik 0.157 R7238 G1 225.01 Y 11 33623594 I109V A G missense Het probably benign 0.009 06/26/2019
21 563021 UTSW Dcaf5 0.551 R7238 G1 225.01 Y 12 80338709 T881K G T missense Het probably benign 0.267 06/26/2019
22 563001 UTSW Dennd4a 0.550 R7238 G1 225.01 Y 9 64861956 T408K C A missense Het probably damaging 1.000 phenotype 06/26/2019
23 563009 UTSW Dnah2 0.000 R7238 G1 225.01 Y 11 69459146 A G critical splice donor site 2 bp Het probably null 0.949 phenotype 06/26/2019
24 563041 UTSW Eif2ak2 0.668 R7238 G1 225.01 Y 17 78866331 V273I C T missense Het probably benign 0.006 phenotype 06/26/2019
25 563044 UTSW Elac1 0.000 R7238 G1 225.01 Y 18 73739288 G212D C T missense Het probably damaging 1.000 phenotype 06/26/2019
26 563025 UTSW Ercc6l2 0.233 R7238 G1 225.01 Y 13 63865984 D623G A G missense Het probably damaging 0.984 phenotype 06/26/2019
27 562945 UTSW Exo1 0.331 R7238 G1 225.01 Y 1 175888847 F177L T C missense Het probably damaging 0.996 phenotype 06/26/2019
28 562957 UTSW Fat4 1.000 R7238 G1 225.01 Y 3 38890413 T1152A A G missense Het probably benign 0.309 phenotype 06/26/2019
29 580593 UTSW Fbxl12 0.000 R7238 G1 225.01 Y 9 20618413 G T splice site Het probably null phenotype 10/10/2019
30 563029 UTSW Fbxo43 0.195 R7238 G1 225.01 Y 15 36151825 Y582C T C missense Het probably damaging 1.000 phenotype 06/26/2019
31 562951 UTSW Fsip2 0.080 R7238 G1 225.01 Y 2 82982140 N2934K T A missense Het possibly damaging 0.719 phenotype 06/26/2019
32 563043 UTSW Gm4951 0.000 R7238 G1 225.01 Y 18 60246283 S297G A G missense Het possibly damaging 0.644 06/26/2019
33 563022 UTSW Gm8300 R7238 G1 225.01 Y 12 87517236 K114* A T nonsense Het probably null 06/26/2019
34 562971 UTSW Gna12 0.787 R7238 G1 149.01 Y 5 140830092 S69P A G missense Het probably damaging 1.000 0.857 phenotype 06/26/2019
35 563017 UTSW Gpatch8 0.381 R7238 G1 225.01 Y 11 102478528 G1395C C A missense Het probably damaging 1.000 phenotype 06/26/2019
36 563027 UTSW Gpr137c 0.086 R7238 G1 225.01 Y 14 45278691 Y294C A G missense Het probably damaging 1.000 0.825 06/26/2019
37 563019 UTSW Greb1 0.000 R7238 G1 225.01 Y 12 16674672 S1834P A G missense Het probably damaging 0.990 phenotype 06/26/2019
38 562982 UTSW Grin2b 1.000 R7238 G1 225.01 Y 6 135780251 D404G T C missense Het probably damaging 0.968 0.170 phenotype 06/26/2019
39 563046 UTSW Hectd2 0.000 R7238 G1 225.01 Y 19 36597078 N236I A T missense Het probably damaging 0.983 06/26/2019
40 562994 UTSW Hhip 1.000 R7238 G1 225.01 Y 8 79987012 V562I C T missense Het probably benign 0.000 phenotype 06/26/2019
41 562973 UTSW Hipk2 0.955 R7238 G1 225.01 Y 6 38716057 T867N G T missense Het probably benign 0.450 phenotype 06/26/2019
42 562960 UTSW Hmgcl 1.000 R7238 G1 225.01 Y 4 135962113 V294A T C missense Het possibly damaging 0.916 phenotype 06/26/2019
43 562984 UTSW Hnrnpl 1.000 R7238 G1 225.01 Y 7 28813975 F158I T A missense Het phenotype 06/26/2019
44 562947 UTSW Hspa5 1.000 R7238 G1 225.01 Y 2 34772371 V17A T C missense Het unknown phenotype 06/26/2019
45 562961 UTSW Hspg2 1.000 R7238 G1 225.01 Y 4 137508393 V168A T C missense Het probably damaging 0.996 phenotype 06/26/2019
46 562942 UTSW Idh1 0.000 R7238 G1 225.01 Y 1 65166125 F227S A G missense Het probably damaging 1.000 phenotype 06/26/2019
47 563020 UTSW Immp2l 0.000 R7238 G1 225.01 Y 12 41110916 V71A T C missense Het possibly damaging 0.948 0.160 phenotype 06/26/2019
48 562970 UTSW Iqce 0.000 R7238 G1 225.01 Y 5 140689958 R193* G A nonsense Het probably null 0.976 06/26/2019
49 562941 UTSW Kcnq5 0.235 R7238 G1 225.01 Y 1 21402302 D907G T C missense Het probably benign 0.390 phenotype 06/26/2019
50 563016 UTSW Krt17 0.000 R7238 G1 225.01 Y 11 100257787 T306S T A missense Het probably benign 0.193 phenotype 06/26/2019
51 562946 UTSW Lhx3 1.000 R7238 G1 225.01 Y 2 26202997 D149G T C missense Het probably damaging 1.000 phenotype 06/26/2019
52 563040 UTSW Lrrc73 0.410 R7238 G1 225.01 Y 17 46254562 R73H G A missense Het probably damaging 0.997 06/26/2019
53 563018 UTSW Mgat5b 0.083 R7238 G1 225.01 Y 11 116984983 S678P T C missense Het probably benign 0.092 phenotype 06/26/2019
54 563010 UTSW Mink1 0.000 R7238 G1 225.01 Y 11 70611479 T C critical splice donor site 2 bp Het probably null 0.950 phenotype 06/26/2019
55 563030 UTSW Mroh5 0.055 R7238 G1 225.01 Y 15 73791429 T G critical splice acceptor site Het probably null 06/26/2019
56 562992 UTSW Muc5ac 0.000 R7238 G1 128.01 N 7 141809517 H2188Q T A missense Het unknown phenotype 06/26/2019
57 562993 UTSW Muc5ac 0.000 R7238 G1 225.01 N 7 141809687 G C intron Het probably benign phenotype 06/26/2019
58 562959 UTSW Musk 1.000 R7238 G1 225.01 Y 4 58344312 G305D G A missense Het probably benign 0.006 0.090 phenotype 06/26/2019
59 563036 UTSW Mx1 0.000 R7238 G1 225.01 Y 16 97448296 I347T A G missense Het unknown phenotype 06/26/2019
60 563011 UTSW Mybbp1a 1.000 R7238 G1 225.01 Y 11 72443512 V198F G T missense Het probably damaging 0.995 0.408 phenotype 06/26/2019
61 563028 UTSW Mycbp2 1.000 R7238 G1 225.01 Y 14 103156297 S2943P A G missense Het probably damaging 0.995 0.153 phenotype 06/26/2019
62 563013 UTSW Myo18a 1.000 R7238 G1 225.01 Y 11 77842233 R1363K G A missense Het probably damaging 0.964 0.201 phenotype 06/26/2019
63 563005 UTSW Nav3 0.000 R7238 G1 225.01 Y 10 109853324 D364V T A missense Het possibly damaging 0.750 phenotype 06/26/2019
64 563038 UTSW Olfr127 0.055 R7238 G1 225.01 Y 17 37904437 L297S T C missense Het probably benign 0.365 0.090 phenotype 06/26/2019
65 563034 UTSW Olfr178 0.079 R7238 G1 225.01 Y 16 58889889 E110D T A missense Het probably damaging 0.997 phenotype 06/26/2019
66 562988 UTSW Olfr309 0.055 R7238 G1 225.01 Y 7 86306591 H174R T C missense Het probably damaging 1.000 phenotype 06/26/2019
67 562948 UTSW Olfr341 0.081 R7238 G1 225.01 Y 2 36479714 N139Y T A missense Het possibly damaging 0.536 phenotype 06/26/2019
68 563012 UTSW Olfr385 0.129 R7238 G1 225.01 Y 11 73589735 M1K A T start codon destroyed Het probably null 0.993 0.796 phenotype 06/26/2019
69 562943 UTSW Pecr 0.092 R7238 G1 225.01 Y 1 72259433 D276G T C missense Het probably damaging 0.985 06/26/2019
70 562997 UTSW Pkd1l3 0.000 R7238 G1 214.46 Y 8 109624195 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA small deletion Het probably benign 0.085 phenotype 06/26/2019
71 562965 UTSW Ppp1cb 1.000 R7238 G1 225.01 Y 5 32491032 T320S A T missense Het probably benign 0.000 phenotype 06/26/2019
72 562972 UTSW Ppp1r9a 0.601 R7238 G1 225.01 Y 6 5159716 K1084N G T missense Het probably damaging 0.997 phenotype 06/26/2019
73 562962 UTSW Prdm2 0.000 R7238 G1 225.01 Y 4 143135821 S300P A G missense Het probably benign 0.348 phenotype 06/26/2019
74 563045 UTSW Prkg1 0.614 R7238 G1 225.01 Y 19 30624690 V389I C T missense Het probably damaging 1.000 phenotype 06/26/2019
75 562983 UTSW Psg25 0.056 R7238 G1 199.01 Y 7 18532202 C T start gained Het probably benign 0.090 06/26/2019
76 562979 UTSW Ptpn6 0.514 R7238 G1 225.01 Y 6 124721858 S498P A G missense Het possibly damaging 0.891 0.426 phenotype 06/26/2019
77 563000 UTSW Pus3 0.186 R7238 G1 225.01 Y 9 35566669 H399R A G missense Het probably benign 0.000 phenotype 06/26/2019
78 562964 UTSW Pus7 0.268 R7238 G1 225.01 Y 5 23778452 T6A T C missense Het probably benign 0.004 06/26/2019
79 562991 UTSW Rnf169 0.210 R7238 G1 225.01 Y 7 99925747 V547A A G missense Het probably benign 0.099 06/26/2019
80 562990 UTSW Rsf1 1.000 R7238 G1 217.47 N 7 97579921 GGCGGCGGC GGCGGCGGCCGCGGCGGC unclassified Het probably benign phenotype 06/26/2019
81 562985 UTSW Ryr1 1.000 R7238 G1 225.01 Y 7 29095382 D1194N C T missense Het probably benign 0.242 phenotype 06/26/2019
82 563004 UTSW Scn5a 1.000 R7238 G1 225.01 Y 9 119491544 M1490V T C missense Het possibly damaging 0.729 phenotype 06/26/2019
83 562954 UTSW Sec23b 1.000 R7238 G1 225.01 Y 2 144590338 D756G A G missense Het possibly damaging 0.869 0.241 phenotype 06/26/2019
84 563031 UTSW Selenoo 0.079 R7238 G1 158.01 N 15 89089224 M39K T A missense Het probably benign 0.150 phenotype 06/26/2019
85 563007 UTSW Sept8 0.156 R7238 G1 225.01 Y 11 53536692 V246G T G missense Het possibly damaging 0.684 phenotype 06/26/2019
86 563023 UTSW Serpina3k 0.057 R7238 G1 225.01 Y 12 104343108 N270K T A missense Het probably damaging 1.000 06/26/2019
87 562976 UTSW Setd5 1.000 R7238 G1 225.01 Y 6 113121130 R710H G A missense Het probably damaging 0.996 0.143 phenotype 06/26/2019
88 562968 UTSW Sirt4 0.000 R7238 G1 225.01 Y 5 115482990 I41N A T missense Het possibly damaging 0.763 phenotype 06/26/2019
89 562944 UTSW Slc26a9 0.895 R7238 G1 225.01 Y 1 131758818 Y425* T A nonsense Het probably null phenotype 06/26/2019
90 563042 UTSW Slc4a9 0.215 R7238 G1 225.01 Y 18 36529720 E176G A G missense Het probably benign 0.005 phenotype 06/26/2019
91 563032 UTSW Spidr 0.000 R7238 G1 225.01 Y 16 15966816 W463R A T missense Het probably benign 0.105 0.076 06/26/2019
92 562989 UTSW Tenm4 1.000 R7238 G1 225.01 Y 7 96553496 R106H G A missense Het probably benign 0.011 0.090 phenotype 06/26/2019
93 562978 UTSW Tmcc1 0.315 R7238 G1 225.01 Y 6 116134237 Q28* G A nonsense Het probably null 0.976 06/26/2019
94 562981 UTSW Tmem52b 0.053 R7238 G1 225.01 Y 6 129516688 E88G A G missense Het probably damaging 1.000 0.544 06/26/2019
95 580594 UTSW Trpc7 0.143 R7238 G1 225.01 Y 13 56826897 I402K A T missense Het probably benign 0.167 phenotype 10/10/2019
96 562986 UTSW Tshz3 1.000 R7238 G1 225.01 Y 7 36770097 Y504H T C missense Het probably damaging 0.999 phenotype 06/26/2019
97 562949 UTSW Ttn 1.000 R7238 G1 225.01 Y 2 76712205 E33479G T C missense Het possibly damaging 0.689 phenotype 06/26/2019
98 562950 UTSW Ttn 1.000 R7238 G1 225.01 Y 2 76881328 R8290C G A missense Het unknown 0.075 phenotype 06/26/2019
99 563035 UTSW Urb1 1.000 R7238 G1 225.01 Y 16 90752115 D2235G T C missense Het possibly damaging 0.880 06/26/2019
100 562999 UTSW Usp10 1.000 R7238 G1 225.01 Y 8 119941544 F195L T C missense Het probably benign 0.000 phenotype 06/26/2019
[records 1 to 100 of 107] next >> last >|