Incidental Mutations

52 incidental mutations are currently displayed, and affect 52 genes.
9 are Possibly Damaging.
15 are Probably Damaging.
20 are Probably Benign.
3 are Probably Null.
1 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 52 of 52] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 563131 UTSW 2210017I01Rik R7240 G1 225.01 Y 3 92605075 I59T A G missense Het unknown 06/26/2019
2 563122 UTSW Aspm 0.000 R7240 G1 225.01 Y 1 139478651 Q1759* C T nonsense Het probably null 0.971 phenotype 06/26/2019
3 563139 UTSW Atn1 0.000 R7240 G1 225.01 Y 6 124747898 I124K A T missense Het unknown phenotype 06/26/2019
4 563129 UTSW Catsper2 0.145 R7240 G1 135.47 N 2 121397572 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT utr 3 prime Het probably benign phenotype 06/26/2019
5 563159 UTSW Ccdc88c 0.000 R7240 G1 225.01 Y 12 100944939 V879M C T missense Het probably benign 0.165 phenotype 06/26/2019
6 563158 UTSW Cd300c 0.000 R7240 G1 225.01 Y 11 114959783 C65R A G missense Het possibly damaging 0.933 0.392 06/26/2019
7 563140 UTSW Cd69 0.072 R7240 G1 225.01 Y 6 129270042 S112T A T missense Het possibly damaging 0.781 phenotype 06/26/2019
8 563120 UTSW Cdh19 0.000 R7240 G1 225.01 Y 1 110893407 T534A T C missense Het probably benign 0.000 0.077 phenotype 06/26/2019
9 563133 UTSW Cdk5rap2 0.368 R7240 G1 225.01 Y 4 70291908 D701V T A missense Het probably damaging 0.998 phenotype 06/26/2019
10 563155 UTSW D130052B06Rik 0.129 R7240 G1 225.01 Y 11 33623874 H157R A G missense Het possibly damaging 0.787 06/26/2019
11 563142 UTSW Dpf1 0.000 R7240 G1 225.01 Y 7 29311627 F150L T A missense Het probably benign 0.007 06/26/2019
12 563167 UTSW Dsg1c 0.000 R7240 G1 225.01 Y 18 20283109 L689P T C missense Het probably damaging 1.000 phenotype 06/26/2019
13 563121 UTSW Dstyk 0.167 R7240 G1 225.01 Y 1 132454123 M538I G A missense Het probably benign 0.017 phenotype 06/26/2019
14 563165 UTSW E4f1 1.000 R7240 G1 225.01 Y 17 24444325 I669F T A missense Het probably damaging 1.000 phenotype 06/26/2019
15 563151 UTSW Gm7138 0.088 R7240 G1 225.01 N 10 77776755 T64A T C missense Het unknown 06/26/2019
16 563149 UTSW Gnai2 0.776 R7240 G1 225.01 Y 9 107615773 D310E A C missense Het 0.087 phenotype 06/26/2019
17 563119 UTSW Iqca 0.000 R7240 G1 225.01 Y 1 90070550 V567A A G missense Het possibly damaging 0.878 phenotype 06/26/2019
18 563143 UTSW Iqgap1 0.000 R7240 G1 225.01 Y 7 80759839 N249K A T missense Het probably benign 0.223 phenotype 06/26/2019
19 563123 UTSW Lamc1 1.000 R7240 G1 225.01 Y 1 153234650 V1093A A G missense Het possibly damaging 0.816 0.081 phenotype 06/26/2019
20 563156 UTSW Mfap3 0.091 R7240 G1 225.01 Y 11 57529756 K188E A G missense Het probably damaging 1.000 0.114 06/26/2019
21 563134 UTSW N4bp2 0.145 R7240 G1 225.01 Y 5 65794545 V431D T A missense Het probably damaging 0.958 0.647 phenotype 06/26/2019
22 563166 UTSW Notch4 0.000 R7240 G1 225.01 Y 17 34576471 T792A A G missense Het probably benign 0.002 phenotype 06/26/2019
23 563154 UTSW Ntn4 0.000 R7240 G1 225.01 Y 10 93745741 H592R A G missense Het probably damaging 0.985 phenotype 06/26/2019
24 563161 UTSW Ofcc1 0.000 R7240 G1 224.01 N 13 40208841 C202R A G missense Het probably benign 0.000 phenotype 06/26/2019
25 563137 UTSW Olfr13 0.493 R7240 G1 225.01 Y 6 43174501 K172E A G missense Het probably benign 0.000 phenotype 06/26/2019
26 563124 UTSW Olfr418 0.126 R7240 G1 225.01 Y 1 173270994 I273T T C missense Het probably benign 0.269 0.090 phenotype 06/26/2019
27 563144 UTSW Olfr476 0.085 R7240 G1 225.01 Y 7 107968188 S264P T C missense Het probably benign 0.417 phenotype 06/26/2019
28 563145 UTSW Olfr497 0.068 R7240 G1 225.01 Y 7 108422933 M121V A G missense Het probably damaging 1.000 phenotype 06/26/2019
29 563147 UTSW Olfr922 0.057 R7240 G1 225.01 Y 9 38815713 D70G A G missense Het probably benign 0.006 0.090 phenotype 06/26/2019
30 563148 UTSW Olfr938 0.063 R7240 G1 225.01 Y 9 39078610 M45K A T missense Het probably damaging 0.992 0.647 phenotype 06/26/2019
31 563153 UTSW Parpbp 0.000 R7240 G1 225.01 Y 10 88124940 T228I G A missense Het probably damaging 0.993 06/26/2019
32 563168 UTSW Pcdhgb8 0.121 R7240 G1 225.01 Y 18 37763703 V609M G A missense Het probably damaging 0.994 06/26/2019
33 563128 UTSW Pla2g4d 0.068 R7240 G1 225.01 Y 2 120270349 N543S T C missense Het probably damaging 1.000 phenotype 06/26/2019
34 574703 UTSW Puf60 0.956 R7240 G1 225.01 Y 15 76072539 A G unclassified Het probably benign phenotype 10/07/2019
35 563150 UTSW Rbm6 0.938 R7240 G1 225.01 Y 9 107852896 D184E A T missense Het probably damaging 1.000 0.122 06/26/2019
36 563162 UTSW Rnase9 0.000 R7240 G1 225.01 Y 14 51038979 S181A A C missense Het probably benign 0.117 phenotype 06/26/2019
37 563132 UTSW Rnpc3 1.000 R7240 G1 225.01 Y 3 113616831 R270S T A missense Het probably damaging 0.999 phenotype 06/26/2019
38 563157 UTSW Rundc1 0.799 R7240 G1 225.01 Y 11 101431548 T C critical splice donor site 2 bp Het probably null 06/26/2019
39 563141 UTSW Ryr1 1.000 R7240 G1 225.01 Y 7 29052015 S3715G T C missense Het possibly damaging 0.954 0.249 phenotype 06/26/2019
40 563126 UTSW Scn3a 1.000 R7240 G1 225.01 Y 2 65469042 D1373E A T missense Het possibly damaging 0.772 0.165 phenotype 06/26/2019
41 563160 UTSW Serpina3k 0.059 R7240 G1 225.01 Y 12 104340602 I31S T G missense Het probably benign 0.047 06/26/2019
42 563146 UTSW Sipa1l2 0.408 R7240 G1 225.01 Y 8 125469860 F712L A G missense Het probably damaging 0.999 phenotype 06/26/2019
43 563169 UTSW Slc22a29 0.000 R7240 G1 225.01 Y 19 8161511 V529A A G missense Het probably damaging 0.977 06/26/2019
44 563163 UTSW Tdrd3 0.421 R7240 G1 225.01 Y 14 87458803 N58S A G missense Het probably benign 0.057 phenotype 06/26/2019
45 563130 UTSW Tmc2 0.210 R7240 G1 225.01 Y 2 130234804 T350I C T missense Het possibly damaging 0.800 phenotype 06/26/2019
46 563135 UTSW Tpst2 0.683 R7240 G1 225.01 Y 5 112307678 C28R T C missense Het probably benign 0.048 0.353 phenotype 06/26/2019
47 563136 UTSW Trbv21 0.059 R7240 G1 225.01 Y 6 41202958 K69N A T missense Het probably benign 0.044 06/26/2019
48 563152 UTSW Trpm2 0.124 R7240 G1 225.01 Y 10 77935876 A G critical splice donor site 2 bp Het probably null phenotype 06/26/2019
49 563127 UTSW Ttn 1.000 R7240 G1 225.01 Y 2 76848990 V10796A A G missense Het unknown phenotype 06/26/2019
50 563125 UTSW Ush2a 0.572 R7240 G1 225.01 Y 1 188911661 T4407A A G missense Het possibly damaging 0.830 0.179 phenotype 06/26/2019
51 563164 UTSW Vmn2r95 0.071 R7240 G1 225.01 Y 17 18451963 H726R A G missense Het probably benign 0.151 06/26/2019
52 563138 UTSW Zfp777 0.867 R7240 G1 225.01 Y 6 48044449 S80P A G missense Het probably benign 0.001 06/26/2019
[records 1 to 52 of 52]