Incidental Mutations

73 incidental mutations are currently displayed, and affect 73 genes.
15 are Possibly Damaging.
18 are Probably Damaging.
25 are Probably Benign.
12 are Probably Null.
8 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 73 of 73] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 565051 UTSW 4930402H24Rik 0.000 R7268 G1 225.01 Y 2 130806788 R258L C A missense Het unknown 0.087 phenotype 06/26/2019
2 565047 UTSW Abl2 0.460 R7268 G1 225.01 Y 1 156633939 T C critical splice donor site 2 bp Het probably null phenotype 06/26/2019
3 565080 UTSW Acsf3 0.086 R7268 G1 225.01 Y 8 122790662 Y399C A G missense Het probably benign 0.155 phenotype 06/26/2019
4 565078 UTSW Acsm5 0.285 R7268 G1 225.01 Y 7 119537288 T361S A T missense Het probably benign 0.376 06/26/2019
5 565045 UTSW Agap1 0.215 R7268 G1 225.01 Y 1 89766348 I456S T G missense Het probably benign 0.018 phenotype 06/26/2019
6 565099 UTSW Ahnak2 0.072 R7268 G1 203.01 N 12 112780802 V70E A T missense Het 06/26/2019
7 565065 UTSW Alb 0.149 R7268 G1 225.01 Y 5 90462716 S52T T A missense Het probably benign 0.152 0.090 phenotype 06/26/2019
8 565079 UTSW Ankle1 0.326 R7268 G1 225.01 Y 8 71407545 T256A A G missense Het probably damaging 0.995 0.101 phenotype 06/26/2019
9 565085 UTSW Armt1 0.133 R7268 G1 225.01 Y 10 4450855 V201M G A missense Het possibly damaging 0.746 06/26/2019
10 565068 UTSW Atp2a2 1.000 R7268 G1 225.01 Y 5 122467729 T388A T C missense Het probably benign 0.003 0.151 phenotype 06/26/2019
11 565069 UTSW Atp6v0a2 0.213 R7268 G1 225.01 Y 5 124719866 L770P T C missense Het probably damaging 1.000 0.960 phenotype 06/26/2019
12 565073 UTSW B4galnt3 0.071 R7268 G1 225.01 Y 6 120215042 W578R A T missense Het possibly damaging 0.924 phenotype 06/26/2019
13 565063 UTSW Babam2 0.747 R7268 G1 225.01 Y 5 31701853 S2P T C missense Het probably damaging 0.998 phenotype 06/26/2019
14 565089 UTSW Baz2a 0.000 R7268 G1 225.01 Y 10 128124221 H1459R A G missense Het possibly damaging 0.663 06/26/2019
15 565055 UTSW Bbs7 0.000 R7268 G1 225.01 Y 3 36604426 R233Q C T missense Het probably benign 0.000 phenotype 06/26/2019
16 565061 UTSW Cacna2d1 0.435 R7268 G1 225.01 Y 5 16370588 G1076R G A missense Het probably damaging 0.994 phenotype 06/26/2019
17 568713 UTSW Camsap2 0.825 R7268 G1 225.01 Y 1 136273745 C T splice site 5 bp Het probably null 09/13/2019
18 565095 UTSW Car10 0.414 R7268 G1 225.01 Y 11 93599251 N273D A G missense Het probably benign 0.258 0.072 phenotype 06/26/2019
19 565103 UTSW Ccdc66 0.154 R7268 G1 225.01 Y 14 27486923 D458G T C missense Het probably benign 0.239 phenotype 06/26/2019
20 565081 UTSW Ccdc7a 0.056 R7268 G1 225.01 Y 8 128881152 H982L T A missense Het possibly damaging 0.663 06/26/2019
21 565043 UTSW Col9a1 0.137 R7268 G1 225.01 Y 1 24207398 K386E A G missense Het possibly damaging 0.886 phenotype 06/26/2019
22 565054 UTSW Ctcfl 0.320 R7268 G1 225.01 Y 2 173107795 I415T A G missense Het probably benign 0.259 0.075 phenotype 06/26/2019
23 565070 UTSW Cyp3a16 0.108 R7268 G1 225.01 Y 5 145467470 Y54* G C nonsense Het probably null 0.976 06/26/2019
24 565108 UTSW Dact2 0.000 R7268 G1 225.01 Y 17 14196535 T468A T C missense Het probably benign 0.015 phenotype 06/26/2019
25 565097 UTSW Dgkb 0.218 R7268 G1 225.01 Y 12 38147555 L355* T A nonsense Het probably null phenotype 06/26/2019
26 565094 UTSW Dhx40 0.000 R7268 G1 225.01 Y 11 86806616 C42S A T missense Het possibly damaging 0.861 0.082 phenotype 06/26/2019
27 565084 UTSW Dopey1 0.240 R7268 G1 225.01 Y 9 86512777 E637* G T nonsense Het probably null 0.976 06/26/2019
28 565050 UTSW Dpp4 0.000 R7268 G1 225.01 Y 2 62347842 P649T G T missense Het probably damaging 1.000 phenotype 06/26/2019
29 565059 UTSW Eri3 0.000 R7268 G1 225.01 Y 4 117649383 I303K T A missense Het probably benign 0.000 06/26/2019
30 565091 UTSW Foxi1 0.257 R7268 G1 225.01 Y 11 34205783 Y282* A T nonsense Het probably null phenotype 06/26/2019
31 565100 UTSW Gdi2 1.000 R7268 G1 225.01 Y 13 3556363 Y146* T A nonsense Het probably null phenotype 06/26/2019
32 565087 UTSW Gns 0.325 R7268 G1 225.01 Y 10 121376652 Y173C A G missense Het probably damaging 1.000 phenotype 06/26/2019
33 565046 UTSW Gpc1 0.000 R7268 G1 225.01 Y 1 92858371 P494Q C A missense Het possibly damaging 0.758 phenotype 06/26/2019
34 565113 UTSW Habp2 0.086 R7268 G1 225.01 Y 19 56314086 G274V G T missense Het probably damaging 1.000 phenotype 06/26/2019
35 565086 UTSW Hcfc2 0.293 R7268 G1 225.01 Y 10 82709012 Y159* T A nonsense Het probably null phenotype 06/26/2019
36 565049 UTSW Hmcn2 0.000 R7268 G1 225.01 Y 2 31457966 S4875T T A missense Het possibly damaging 0.483 06/26/2019
37 565057 UTSW Hmgcs2 0.162 R7268 G1 225.01 Y 3 98297480 N318S A G missense Het probably benign 0.021 phenotype 06/26/2019
38 565109 UTSW Lnpep 0.000 R7268 G1 225.01 Y 17 17538541 M847K A T missense Het probably benign 0.000 phenotype 06/26/2019
39 565058 UTSW Mmp16 0.000 R7268 G1 225.01 Y 4 18093366 M374L A C missense Het probably benign 0.000 phenotype 06/26/2019
40 565096 UTSW Mrpl38 0.949 R7268 G1 225.01 Y 11 116138570 I40T A G missense Het possibly damaging 0.816 phenotype 06/26/2019
41 565048 UTSW Ncstn 1.000 R7268 G1 225.01 Y 1 172081263 T46A T C missense Het possibly damaging 0.860 0.176 phenotype 06/26/2019
42 565093 UTSW Nlrp1a 0.102 R7268 G1 225.01 Y 11 71124242 V61I C T missense Het probably benign 0.001 phenotype 06/26/2019
43 565044 UTSW Npas2 0.000 R7268 G1 225.01 Y 1 39287577 V48L G T missense Het probably damaging 0.983 phenotype 06/26/2019
44 565060 UTSW Olfr1339 0.079 R7268 G1 225.01 Y 4 118735408 Y293C A G missense Het probably damaging 1.000 phenotype 06/26/2019
45 565077 UTSW Olfr655 0.085 R7268 G1 225.01 Y 7 104597077 L35F G A missense Het probably benign 0.000 phenotype 06/26/2019
46 565090 UTSW Olfr782 0.106 R7268 G1 225.01 Y 10 129351394 T277I C T missense Het possibly damaging 0.599 phenotype 06/26/2019
47 565072 UTSW Pcyox1 0.000 R7268 G1 225.01 Y 6 86391731 N268K A T missense Het possibly damaging 0.687 phenotype 06/26/2019
48 568714 UTSW Pramef17 0.053 R7268 G1 225.01 Y 4 143993520 A T splice site Het probably null 09/13/2019
49 565064 UTSW Prr27 0.000 R7268 G1 225.01 Y 5 87843276 L249P T C missense Het probably damaging 0.987 0.647 06/26/2019
50 565111 UTSW Psat1 1.000 R7268 G1 225.01 Y 19 15917144 V168D A T missense Het probably damaging 0.991 phenotype 06/26/2019
51 565074 UTSW Psg17 0.000 R7268 G1 225.01 Y 7 18814661 T395K G T missense Het possibly damaging 0.638 0.324 06/26/2019
52 565053 UTSW Ptgis 0.000 R7268 G1 225.01 Y 2 167206756 Y447H A G missense Het probably benign 0.096 0.218 phenotype 06/26/2019
53 565092 UTSW Rad50 1.000 R7268 G1 225.01 Y 11 53684275 N607I T A missense Het probably benign 0.010 phenotype 06/26/2019
54 565107 UTSW Rps6ka2 0.665 R7268 G1 225.01 Y 17 7295263 Y602H T C missense Het possibly damaging 0.802 phenotype 06/26/2019
55 565083 UTSW Senp6 1.000 R7268 G1 225.01 Y 9 80142124 R1010H G A missense Het probably damaging 1.000 0.647 phenotype 06/26/2019
56 565098 UTSW Slc8a3 0.000 R7268 G1 225.01 Y 12 81315053 D331Y C A missense Het probably damaging 0.976 0.164 phenotype 06/26/2019
57 565105 UTSW Slc9c1 0.516 R7268 G1 225.01 Y 16 45550116 S240N G A missense Het probably damaging 0.999 phenotype 06/26/2019
58 565102 UTSW Slf1 0.000 R7268 G1 225.01 Y 13 77066707 L620P A G missense Het probably damaging 1.000 phenotype 06/26/2019
59 565082 UTSW Snx19 0.109 R7268 G1 225.01 Y 9 30440177 E847G A G missense Het probably damaging 1.000 phenotype 06/26/2019
60 565110 UTSW Spaca6 0.056 R7268 G1 225.01 Y 17 17832107 V103A T C missense Het probably benign 0.088 phenotype 06/26/2019
61 565088 UTSW Tbk1 1.000 R7268 G1 225.01 Y 10 121552499 Y591H A G missense Het probably benign 0.026 phenotype 06/26/2019
62 565056 UTSW Tchh 0.091 R7268 G1 214.46 N 3 93446708 CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC small deletion Het probably benign 06/26/2019
63 565101 UTSW Tfap2a 1.000 R7268 G1 225.01 Y 13 40728760 T15I G A missense Het possibly damaging 0.909 phenotype 06/26/2019
64 565052 UTSW Tgm2 0.198 R7268 G1 225.01 Y 2 158120268 R544* G A nonsense Het probably null phenotype 06/26/2019
65 565067 UTSW Tmem116 0.000 R7268 G1 225.01 Y 5 121467855 I90K T A missense Het 0.129 06/26/2019
66 565106 UTSW Tmem30c 0.073 R7268 G1 225.01 Y 16 57266414 L342R A C missense Het probably damaging 0.978 06/26/2019
67 565112 UTSW Trpm6 1.000 R7268 G1 225.01 Y 19 18778585 T64I C T missense Het probably benign 0.125 phenotype 06/26/2019
68 565104 UTSW Ttll8 0.267 R7268 G1 225.01 Y 15 88934956 A G critical splice donor site 2 bp Het probably null 06/26/2019
69 565042 UTSW Vcpip1 0.415 R7268 G1 225.01 Y 1 9746082 I692T A G missense Het probably damaging 0.994 phenotype 06/26/2019
70 565075 UTSW Vmn1r169 0.066 R7268 G1 225.01 Y 7 23577428 F82V T G missense Het probably benign 0.001 0.090 06/26/2019
71 565076 UTSW Vmn1r178 0.056 R7268 G1 225.01 Y 7 23893953 C142Y G A missense Het probably benign 0.053 0.321 06/26/2019
72 565066 UTSW Vmn2r16 0.207 R7268 G1 225.01 Y 5 109340465 Y401* T A nonsense Het probably null 0.976 06/26/2019
73 565071 UTSW Wdr91 0.194 R7268 G1 210.01 Y 6 34892440 V383A A G missense Het probably benign 0.000 06/26/2019
[records 1 to 73 of 73]