Incidental Mutations

68 incidental mutations are currently displayed, and affect 67 genes.
11 are Possibly Damaging.
22 are Probably Damaging.
20 are Probably Benign.
12 are Probably Null.
9 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 68 of 68] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 566177 UTSW 2810021J22Rik 0.070 R7288 G1 225.01 N 11 58880305 D204E T A missense Het probably benign 0.026 06/26/2019
2 566144 UTSW Adh1 0.000 R7288 G1 225.01 N 3 138282732 D155E T G missense Het probably benign 0.000 phenotype 06/26/2019
3 566156 UTSW Akt1s1 0.220 R7288 G1 225.01 N 7 44849147 L2P T C missense Het unknown phenotype 06/26/2019
4 566143 UTSW Ash1l 1.000 R7288 G1 225.01 N 3 88965892 T A start gained Het probably benign phenotype 06/26/2019
5 566135 UTSW Bend7 0.000 R7288 G1 225.01 N 2 4752830 P228S C T missense Het probably damaging 0.983 06/26/2019
6 566172 UTSW Bpifc 0.084 R7288 G1 225.01 N 10 85988721 E218G T C missense Het possibly damaging 0.952 06/26/2019
7 566149 UTSW Cdk6 0.000 R7288 G1 175.01 N 5 3429001 F127Y T A missense Het probably benign 0.000 phenotype 06/26/2019
8 566166 UTSW Cgnl1 0.000 R7288 G1 225.01 N 9 71725564 H168Q A T missense Het possibly damaging 0.672 phenotype 06/26/2019
9 566147 UTSW Chd7 0.942 R7288 G1 225.01 N 4 8847093 T1612I C T missense Het possibly damaging 0.922 phenotype 06/26/2019
10 566133 UTSW Col4a4 0.146 R7288 G1 225.01 N 1 82492463 C782S A T missense Het unknown phenotype 06/26/2019
11 566154 UTSW Copg2 0.910 R7288 G1 225.01 N 6 30824406 I364L T A missense Het probably damaging 0.996 06/26/2019
12 566132 UTSW Crygb 0.000 R7288 G1 225.01 N 1 65081925 L81P A G missense Het probably benign 0.016 phenotype 06/26/2019
13 566161 UTSW Cyp4f18 0.000 R7288 G1 225.01 N 8 71993173 M326K A T missense Het probably damaging 0.997 phenotype 06/26/2019
14 566155 UTSW Dhx34 0.364 R7288 G1 225.01 N 7 16215436 S356P A G missense Het probably benign 0.075 phenotype 06/26/2019
15 566159 UTSW Dmbt1 0.187 R7288 G1 225.01 N 7 131083789 Q855* C T nonsense Het probably null phenotype 06/26/2019
16 566196 UTSW Dnph1 0.235 R7288 G1 225.01 N 17 46499012 N160S A G missense Het probably benign 0.000 phenotype 06/26/2019
17 566198 UTSW Esrra 0.000 R7288 G1 225.01 N 19 6912771 C228* A T nonsense Het probably null phenotype 06/26/2019
18 566179 UTSW Evpl 0.000 R7288 G1 225.01 N 11 116223949 N972D T C missense Het probably benign 0.000 phenotype 06/26/2019
19 566163 UTSW Fat3 0.540 R7288 G1 225.01 N 9 15998592 D2038G T C missense Het probably damaging 1.000 phenotype 06/26/2019
20 566187 UTSW Fhit 0.658 R7288 G1 225.01 N 14 9763784 R102W T A missense Het probably damaging 1.000 phenotype 06/26/2019
21 566174 UTSW Gal3st1 0.000 R7288 G1 225.01 N 11 3998609 D272V A T missense Het probably damaging 1.000 phenotype 06/26/2019
22 566175 UTSW Gal3st1 0.000 R7288 G1 225.01 N 11 3998651 V286D T A missense Het probably damaging 0.984 phenotype 06/26/2019
23 566178 UTSW Gemin4 0.958 R7288 G1 225.01 N 11 76213380 M185K A T missense Het possibly damaging 0.597 phenotype 06/26/2019
24 566182 UTSW Hecw1 0.000 R7288 G1 225.01 N 13 14316236 I311V T C missense Het probably benign 0.001 06/26/2019
25 566150 UTSW Ift172 1.000 R7288 G1 225.01 N 5 31285286 Y179C T C missense Het probably damaging 1.000 phenotype 06/26/2019
26 566181 UTSW Ighv7-3 0.123 R7288 G1 225.01 N 12 114153343 W66* C T nonsense Het probably null 06/26/2019
27 566142 UTSW Iqgap3 0.352 R7288 G1 225.01 N 3 88108835 I975N T A missense Het probably damaging 1.000 06/26/2019
28 566192 UTSW Khdrbs3 0.000 R7288 G1 225.01 N 15 69049413 E281G A G missense Het possibly damaging 0.953 phenotype 06/26/2019
29 566168 UTSW Lamb2 0.770 R7288 G1 225.01 N 9 108488324 T1369S A T missense Het probably benign 0.201 phenotype 06/26/2019
30 566137 UTSW Mettl8 0.892 R7288 G1 225.01 N 2 70982038 D84E A T missense Het probably benign 0.010 phenotype 06/26/2019
31 566157 UTSW Mrgprb3 0.080 R7288 G1 225.01 N 7 48643311 C164F C A missense Het probably damaging 1.000 06/26/2019
32 566141 UTSW Mtg2 1.000 R7288 G1 225.01 N 2 180083387 Y131C A G missense Het probably damaging 1.000 phenotype 06/26/2019
33 566162 UTSW Nacc1 0.000 R7288 G1 225.01 N 8 84676545 A234T C T missense Het probably benign 0.000 phenotype 06/26/2019
34 566146 UTSW Nsmaf 0.115 R7288 G1 225.01 N 4 6416641 V551I C T missense Het probably benign 0.000 phenotype 06/26/2019
35 566160 UTSW Olfr541 0.073 R7288 G1 225.01 N 7 140705029 C259* T A nonsense Het probably null phenotype 06/26/2019
36 566164 UTSW Olfr869 0.071 R7288 G1 225.01 N 9 20137441 Y108* T A nonsense Het probably null phenotype 06/26/2019
37 566189 UTSW Oxr1 0.000 R7288 G1 225.01 N 15 41813608 P187L C T missense Het not run phenotype 06/26/2019
38 566197 UTSW Pcdhb12 0.065 R7288 G1 225.01 N 18 37436015 D71E T A missense Het probably benign 0.068 06/26/2019
39 566140 UTSW Pigt 0.840 R7288 G1 214.46 N 2 164499669 CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT frame shift Het probably null phenotype 06/26/2019
40 566165 UTSW Pkm 1.000 R7288 G1 225.01 N 9 59668913 S127G A G missense Het probably benign 0.002 phenotype 06/26/2019
41 566134 UTSW Plxna2 0.000 R7288 G1 225.01 N 1 194796919 L1296H T A missense Het probably damaging 1.000 phenotype 06/26/2019
42 566169 UTSW Ppil6 0.145 R7288 G1 225.01 N 10 41498528 T135R C G missense Het probably benign 0.028 06/26/2019
43 566167 UTSW Ppp2r3a 0.000 R7288 G1 225.01 N 9 101127004 Y378C T C missense Het probably damaging 0.975 phenotype 06/26/2019
44 566158 UTSW Rabep2 0.682 R7288 G1 225.01 N 7 126444205 R426C C T missense Het probably damaging 1.000 06/26/2019
45 566190 UTSW Rad21 1.000 R7288 G1 225.01 N 15 51982580 H31Q A T missense Het possibly damaging 0.937 phenotype 06/26/2019
46 566176 UTSW Rad50 1.000 R7288 G1 225.01 N 11 53654949 Y1182* G T nonsense Het probably null phenotype 06/26/2019
47 566185 UTSW Serpinb9c 0.000 R7288 G1 225.01 N 13 33151900 A218T C T missense Het possibly damaging 0.664 06/26/2019
48 566184 UTSW Slc17a2 0.075 R7288 G1 225.01 N 13 23819112 H248Q C A missense Het probably benign 0.091 06/26/2019
49 566193 UTSW Slc45a4 0.000 R7288 G1 225.01 N 15 73586936 E255* C A nonsense Het probably null 06/26/2019
50 566180 UTSW Slc8a3 0.000 R7288 G1 225.01 N 12 81216824 K596N T A missense Het possibly damaging 0.704 phenotype 06/26/2019
51 566170 UTSW Tbc1d32 0.910 R7288 G1 225.01 N 10 56051387 A C critical splice donor site 2 bp Het probably null phenotype 06/26/2019
52 566153 UTSW Tbl2 0.157 R7288 G1 225.01 N 5 135154399 I112N T A missense Het possibly damaging 0.921 phenotype 06/26/2019
53 566152 UTSW Tchp 0.000 R7288 G1 225.01 N 5 114715569 K238T A C missense Het probably damaging 1.000 06/26/2019
54 566131 UTSW Tfap2d 0.000 R7288 G1 225.01 N 1 19118983 G251D G A missense Het probably damaging 1.000 phenotype 06/26/2019
55 566188 UTSW Thrb 0.375 R7288 G1 225.01 N 14 18030186 M324K T A missense Het probably damaging 0.999 phenotype 06/26/2019
56 566171 UTSW Tmem259 0.000 R7288 G1 225.01 N 10 79978466 L328Q A T missense Het probably damaging 0.999 06/26/2019
57 566173 UTSW Tmtc2 0.125 R7288 G1 225.01 N 10 105413608 H88R T C missense Het probably damaging 1.000 phenotype 06/26/2019
58 566195 UTSW Tnfrsf21 0.177 R7288 G1 225.01 N 17 43037818 H107R A G missense Het possibly damaging 0.861 phenotype 06/26/2019
59 566191 UTSW Trib1 0.000 R7288 G1 225.01 N 15 59654622 V347A T C missense Het probably benign 0.000 phenotype 06/26/2019
60 566151 UTSW Ung 0.941 R7288 G1 225.01 N 5 114131254 L9* T A nonsense Het probably null phenotype 06/26/2019
61 566183 UTSW Vmn1r195 0.060 R7288 G1 225.01 N 13 22279004 V215F G T missense Het probably damaging 1.000 06/26/2019
62 566145 UTSW Wdr63 0.126 R7288 G1 225.01 N 3 146081252 T343A T C missense Het probably damaging 0.973 06/26/2019
63 566194 UTSW Wdr90 0.105 R7288 G1 225.01 N 17 25846312 S1657P A G missense Het probably benign 0.032 06/26/2019
64 566136 UTSW Wdsub1 0.120 R7288 G1 225.01 N 2 59878143 Y129N A T missense Het possibly damaging 0.500 06/26/2019
65 566186 UTSW Zfp369 0.096 R7288 G1 225.01 N 13 65285018 T G critical splice donor site 2 bp Het probably null 06/26/2019
66 566138 UTSW Zfp770 0.171 R7288 G1 225.01 N 2 114195661 C642* G T nonsense Het probably null 06/26/2019
67 566148 UTSW Zfp981 0.081 R7288 G1 121.01 N 4 146537643 R342C C T missense Het probably benign 0.321 06/26/2019
68 566139 UTSW Zhx3 1.000 R7288 G1 225.01 N 2 160781122 V375G A C missense Het probably damaging 1.000 phenotype 06/26/2019
[records 1 to 68 of 68]