Incidental Mutations

66 incidental mutations are currently displayed, and affect 66 genes.
11 are Possibly Damaging.
23 are Probably Damaging.
18 are Probably Benign.
9 are Probably Null.
4 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 66 of 66] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 566469 UTSW 1700007K13Rik 0.065 R7292 G1 154.49 Y 2 28466110 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC small deletion Het probably benign phenotype 06/26/2019
2 566514 UTSW 1700010I14Rik 0.000 R7292 G1 225.01 Y 17 8997029 C322* T A nonsense Het probably null 06/26/2019
3 566519 UTSW 1700019N19Rik 0.000 R7292 G1 225.01 Y 19 58789107 Y90* A T nonsense Het probably null 06/26/2019
4 566461 UTSW 2310035C23Rik 0.517 R7292 G1 225.01 Y 1 105721416 G T critical splice donor site 1 bp Het probably null 06/26/2019
5 566476 UTSW 4930553M12Rik 0.075 R7292 G1 225.01 Y 4 88868331 R17C G A missense Het unknown 06/26/2019
6 566489 UTSW Abcc8 0.446 R7292 G1 225.01 Y 7 46135526 T726I G A missense Het probably benign 0.000 phenotype 06/26/2019
7 566495 UTSW Adamts18 0.117 R7292 G1 225.01 Y 8 113709645 T981A T C missense Het probably benign 0.002 phenotype 06/26/2019
8 566458 UTSW Adgrb3 0.407 R7292 G1 225.01 Y 1 25531876 C507R A G missense Het probably damaging 1.000 phenotype 06/26/2019
9 566472 UTSW Bloc1s6 0.190 R7292 G1 225.01 Y 2 122742695 D63E T A missense Het probably damaging 1.000 phenotype 06/26/2019
10 566473 UTSW Cdc25b 0.000 R7292 G1 225.01 Y 2 131191173 R135W C T missense Het probably damaging 1.000 phenotype 06/26/2019
11 566510 UTSW Cdca2 0.110 R7292 G1 225.01 Y 14 67677877 Y644* G T nonsense Het probably null phenotype 06/26/2019
12 566488 UTSW Ceacam10 0.000 R7292 G1 225.01 Y 7 24778350 G97C G T missense Het probably damaging 1.000 phenotype 06/26/2019
13 566466 UTSW Cenpf 0.617 R7292 G1 225.01 Y 1 189650694 L2668F G A missense Het probably damaging 0.996 0.647 phenotype 06/26/2019
14 566494 UTSW Cog4 0.946 R7292 G1 225.01 Y 8 110881828 D774G A G missense Het probably damaging 1.000 phenotype 06/26/2019
15 566516 UTSW Col11a2 0.887 R7292 G1 225.01 Y 17 34051508 G511E G A missense Het unknown 0.429 phenotype 06/26/2019
16 566457 UTSW Col19a1 1.000 R7292 G1 225.01 Y 1 24530008 I220F T A missense Het unknown phenotype 06/26/2019
17 566468 UTSW Cubn 1.000 R7292 G1 225.01 Y 2 13424739 T1317K G T missense Het probably damaging 0.991 0.647 phenotype 06/26/2019
18 566481 UTSW Dnaaf5 0.197 R7292 G1 225.01 Y 5 139150317 L24P T C missense Het unknown phenotype 06/26/2019
19 566490 UTSW Fan1 0.000 R7292 G1 225.01 Y 7 64372486 N340Y T A missense Het probably damaging 0.974 0.101 phenotype 06/26/2019
20 566479 UTSW Foxn4 1.000 R7292 G1 225.01 Y 5 114258655 E256* C A nonsense Het probably null phenotype 06/26/2019
21 566482 UTSW Gm4869 0.231 R7292 G1 225.01 Y 5 140471670 D398G A G missense Het probably benign 0.450 06/26/2019
22 566485 UTSW Gm5580 0.187 R7292 G1 225.01 Y 6 116551477 R105Q G A missense Het probably damaging 0.984 06/26/2019
23 590991 UTSW Gm5930 0.055 R7292 G1 43.01 Y 14 44336557 S108P A G missense Het probably damaging 0.995 11/01/2019
24 566507 UTSW Gnl3 1.000 R7292 G1 225.01 Y 14 31013232 S468P A G missense Het probably benign 0.000 phenotype 06/26/2019
25 566509 UTSW Gzmb 0.085 R7292 G1 225.01 Y 14 56262119 S11T A T missense Het probably benign 0.235 phenotype 06/26/2019
26 590989 UTSW Hmcn1 0.000 R7292 G1 186.01 Y 1 150733129 T C intron Het probably null phenotype 11/01/2019
27 566464 UTSW Ifi206 0.111 R7292 G1 225.01 Y 1 173473862 L750P A G missense Het unknown 0.138 06/26/2019
28 566465 UTSW Ifi213 0.059 R7292 G1 225.01 Y 1 173595125 E58V T A missense Het probably damaging 0.987 0.450 06/26/2019
29 566483 UTSW Igkv4-78 0.608 R7292 G1 225.01 Y 6 69059768 Y94N A T missense Het probably damaging 1.000 06/26/2019
30 566463 UTSW Igsf9 0.000 R7292 G1 225.01 Y 1 172491757 G T critical splice donor site 1 bp Het probably null 0.949 phenotype 06/26/2019
31 566486 UTSW Itpr2 0.000 R7292 G1 225.01 Y 6 146158949 L2490M G T missense Het possibly damaging 0.949 phenotype 06/26/2019
32 566480 UTSW Kdm2b 1.000 R7292 G1 225.01 Y 5 122880791 F862S A G missense Het probably damaging 0.975 phenotype 06/26/2019
33 566503 UTSW Meis1 1.000 R7292 G1 225.01 Y 11 19011351 I174T A G missense Het probably damaging 0.997 phenotype 06/26/2019
34 566492 UTSW Micu3 0.000 R7292 G1 225.01 Y 8 40382125 Q507R A G missense Het probably benign 0.093 06/26/2019
35 566459 UTSW Mpp4 0.000 R7292 G1 225.01 Y 1 59143810 E313K C T missense Het possibly damaging 0.509 phenotype 06/26/2019
36 566508 UTSW Nfatc4 0.000 R7292 G1 225.01 Y 14 55825055 E7K G A missense Het probably damaging 0.995 phenotype 06/26/2019
37 566506 UTSW Olfr466 0.062 R7292 G1 225.01 Y 13 65152842 V206D T A missense Het possibly damaging 0.945 phenotype 06/26/2019
38 566496 UTSW Olfr828 0.124 R7292 G1 225.01 Y 9 18816190 Y35N A T missense Het probably damaging 1.000 phenotype 06/26/2019
39 566491 UTSW Osbpl5 0.000 R7292 G1 225.01 Y 7 143701278 P470S G A missense Het probably damaging 1.000 phenotype 06/26/2019
40 566471 UTSW Pak6 0.000 R7292 G1 225.01 Y 2 118693591 D409G A G missense Het possibly damaging 0.950 phenotype 06/26/2019
41 566512 UTSW Pkhd1l1 0.000 R7292 G1 225.01 Y 15 44498590 M553K T A missense Het probably benign 0.000 06/26/2019
42 566499 UTSW Ppp2r3a 0.000 R7292 G1 225.01 Y 9 101212672 N151D T C missense Het probably damaging 0.959 phenotype 06/26/2019
43 566470 UTSW Prdm12 1.000 R7292 G1 225.01 Y 2 31643850 W160R T C missense Het probably damaging 1.000 06/26/2019
44 566477 UTSW Prdm2 0.000 R7292 G1 225.01 Y 4 143132901 T1273M G A missense Het possibly damaging 0.956 phenotype 06/26/2019
45 590990 UTSW Prl2a1 0.076 R7292 G1 225.01 Y 13 27807370 A G intron Het probably null 11/01/2019
46 566518 UTSW Prob1 0.160 R7292 G1 225.01 Y 18 35654550 P217L G A missense Het possibly damaging 0.930 06/26/2019
47 566460 UTSW Ramp1 0.000 R7292 G1 209.01 Y 1 91196777 H20P A C missense Het probably benign 0.003 phenotype 06/26/2019
48 566478 UTSW Rbm47 0.196 R7292 G1 225.01 Y 5 66026750 E170V T A missense Het possibly damaging 0.858 0.750 phenotype 06/26/2019
49 566484 UTSW Rpn1 0.948 R7292 G1 225.01 Y 6 88090084 P142L C T missense Het probably damaging 0.998 phenotype 06/26/2019
50 566467 UTSW Rsu1 0.216 R7292 G1 225.01 Y 2 13170016 R238H C T missense Het probably damaging 0.999 phenotype 06/26/2019
51 566501 UTSW Sh3rf3 0.267 R7292 G1 225.01 Y 10 59071973 P441L C T missense Het probably damaging 0.997 06/26/2019
52 566502 UTSW Slc1a6 0.083 R7292 G1 225.01 Y 10 78814604 S559G A G missense Het possibly damaging 0.841 phenotype 06/26/2019
53 566462 UTSW Slc35f5 0.342 R7292 G1 225.01 Y 1 125572485 S245R C A missense Het probably damaging 0.988 06/26/2019
54 566493 UTSW Spcs3 R7292 G1 225.01 Y 8 54526519 N76D T C missense Het probably benign 0.000 06/26/2019
55 566475 UTSW Svep1 1.000 R7292 G1 225.01 Y 4 58111395 T1075A T C missense Het possibly damaging 0.707 phenotype 06/26/2019
56 566487 UTSW Sympk 0.965 R7292 G1 225.01 Y 7 19036030 I211F A T missense Het probably benign 0.014 phenotype 06/26/2019
57 566505 UTSW Tk1 0.000 R7292 G1 225.01 Y 11 117825777 M1I C T start codon destroyed Het probably null 0.012 0.947 phenotype 06/26/2019
58 566498 UTSW Tln2 0.257 R7292 G1 225.01 Y 9 67346461 V776A A G missense Het probably benign 0.000 0.059 phenotype 06/26/2019
59 566504 UTSW Tmem94 0.206 R7292 G1 225.01 Y 11 115786256 R118L G T missense Het possibly damaging 0.535 0.304 06/26/2019
60 566513 UTSW Tnk2 0.390 R7292 G1 225.01 Y 16 32680800 V977A T C missense Het probably benign 0.000 phenotype 06/26/2019
61 566474 UTSW Toporsl 0.000 R7292 G1 225.01 Y 4 52611630 S508C A T missense Het probably benign 0.144 06/26/2019
62 566500 UTSW Trank1 0.000 R7292 G1 225.01 Y 9 111377870 R1690S A C missense Het probably benign 0.020 06/26/2019
63 566511 UTSW Trio 1.000 R7292 G1 225.01 Y 15 27828351 Q1409L T A missense Het possibly damaging 0.631 phenotype 06/26/2019
64 566517 UTSW Vit 0.080 R7292 G1 225.01 Y 17 78605498 F287L T C missense Het probably benign 0.030 phenotype 06/26/2019
65 566515 UTSW Vmn2r109 0.080 R7292 G1 225.01 Y 17 20541438 D552E G C missense Het probably benign 0.052 06/26/2019
66 566497 UTSW Zw10 0.967 R7292 G1 225.01 Y 9 49061191 V186A T C missense Het probably benign 0.004 phenotype 06/26/2019
[records 1 to 66 of 66]