Incidental Mutations

88 incidental mutations are currently displayed, and affect 87 genes.
11 are Possibly Damaging.
28 are Probably Damaging.
31 are Probably Benign.
13 are Probably Null.
8 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 88 of 88] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 571588 UTSW 1700066M21Rik 0.329 R7296 G1 225.01 Y 1 57383143 M226K T A missense Het probably benign 0.301 0.076 09/13/2019
2 571586 UTSW 2010300C02Rik 0.000 R7296 G1 225.01 Y 1 37614618 T1036A T C missense Het possibly damaging 0.528 0.179 09/13/2019
3 571664 UTSW 4921524L21Rik 0.102 R7296 G1 225.01 Y 18 6626385 S132R T G missense Het probably damaging 0.990 09/13/2019
4 571632 UTSW A4gnt 0.117 R7296 G1 225.01 Y 9 99620282 I165S T G missense Het probably damaging 0.972 phenotype 09/13/2019
5 571624 UTSW Abca14 0.000 R7296 G1 225.01 Y 7 120278311 D1061N G A missense Het probably benign 0.000 0.090 09/13/2019
6 571620 UTSW Abcc9 0.095 R7296 G1 225.01 Y 6 142671593 P582S G A missense Het probably damaging 1.000 0.969 phenotype 09/13/2019
7 571636 UTSW Abhd5 0.000 R7296 G1 225.01 Y 9 122379573 V343I G A missense Het probably benign 0.433 phenotype 09/13/2019
8 571648 UTSW Adam6a 0.074 R7296 G1 225.01 Y 12 113545572 R522C C T missense Het probably damaging 1.000 09/13/2019
9 571611 UTSW Ankle2 0.943 R7296 G1 225.01 Y 5 110237724 R313H G A missense Het probably damaging 1.000 phenotype 09/13/2019
10 571615 UTSW Aplf 0.130 R7296 G1 225.01 Y 6 87646215 T315I G A missense Het probably damaging 0.991 phenotype 09/13/2019
11 571621 UTSW Arntl2 0.278 R7296 G1 225.01 N 6 146822134 V321I G A missense Het not run phenotype 09/13/2019
12 571607 UTSW Asic5 0.000 R7296 G1 225.01 Y 3 82021076 P491S C T missense Het probably benign 0.032 phenotype 09/13/2019
13 571642 UTSW Atp5b 1.000 R7296 G1 225.01 Y 10 128085522 Y230H T C missense Het probably benign 0.178 phenotype 09/13/2019
14 571665 UTSW B4galt6 0.284 R7296 G1 225.01 Y 18 20728042 I51N A T missense Het probably damaging 0.991 phenotype 09/13/2019
15 571662 UTSW C4b 0.000 R7296 G1 225.01 Y 17 34743659 L23S A G missense Het probably damaging 0.999 phenotype 09/13/2019
16 571608 UTSW C77080 0.151 R7296 G1 225.01 Y 4 129225418 Y170H A G missense Het probably damaging 0.995 09/13/2019
17 571605 UTSW Cables2 0.199 R7296 G1 225.01 Y 2 180260336 V410A A G missense Het 09/13/2019
18 571651 UTSW Cdyl 0.651 R7296 G1 225.01 Y 13 35863395 M489V A G missense Het probably damaging 0.998 phenotype 09/13/2019
19 571663 UTSW Clip4 0.143 R7296 G1 225.01 Y 17 71790001 M40T T C missense Het probably damaging 0.989 09/13/2019
20 571631 UTSW Col12a1 0.677 R7296 G1 225.01 Y 9 79682066 Y1069C T C missense Het probably damaging 0.999 phenotype 09/13/2019
21 571590 UTSW Col6a3 0.000 R7296 G1 225.01 Y 1 90827986 M194V T C missense Het probably benign 0.001 phenotype 09/13/2019
22 571645 UTSW Colec11 0.056 R7296 G1 225.01 Y 12 28594715 D260V T A missense Het probably damaging 1.000 phenotype 09/13/2019
23 571612 UTSW Cux2 0.359 R7296 G1 225.01 Y 5 121861256 D1207G T C missense Het probably benign 0.245 phenotype 09/13/2019
24 571654 UTSW Cyp2d34 0.065 R7296 G1 225.01 Y 15 82617235 N297K G T missense Het possibly damaging 0.871 09/13/2019
25 571625 UTSW Dmbt1 0.218 R7296 G1 225.01 Y 7 131112132 Y1643C A G missense Het unknown 0.087 phenotype 09/13/2019
26 571601 UTSW Dnmt3c 0.103 R7296 G1 225.01 Y 2 153715026 T288A A G missense Het probably benign 0.084 phenotype 09/13/2019
27 571669 UTSW Dock8 0.091 R7296 G1 225.01 Y 19 25184881 F1842I T A missense Het probably benign 0.001 phenotype 09/13/2019
28 571614 UTSW Dysf 0.000 R7296 G1 225.01 Y 6 84106898 I740V A G missense Het probably benign 0.326 phenotype 09/13/2019
29 571659 UTSW Epha6 0.000 R7296 G1 225.01 Y 16 59915838 M778L T A missense Het probably benign 0.002 phenotype 09/13/2019
30 571623 UTSW Eri2 0.210 R7296 G1 225.01 Y 7 119786516 L254* A T nonsense Het probably null 0.976 09/13/2019
31 571592 UTSW Fam129b 0.334 R7296 G1 225.01 Y 2 32922642 S468P T C missense Het possibly damaging 0.736 09/13/2019
32 571609 UTSW Fam43b 0.478 R7296 G1 225.01 Y 4 138395841 F56S A G missense Het probably damaging 0.996 09/13/2019
33 571606 UTSW Fat4 1.000 R7296 G1 225.01 Y 3 38889145 S729* C A nonsense Het probably null phenotype 09/13/2019
34 571634 UTSW Fbxw22 0.055 R7296 G1 225.01 Y 9 109382075 W386L C A missense Het probably benign 0.000 09/13/2019
35 571640 UTSW Fgd6 0.539 R7296 G1 225.01 Y 10 94044047 C254* T A nonsense Het probably null 09/13/2019
36 571641 UTSW Fgd6 0.539 R7296 G1 225.01 Y 10 94139881 T1386K C A missense Het probably benign 0.024 09/13/2019
37 571595 UTSW Fkbp7 0.000 R7296 G1 225.01 Y 2 76671764 D98E G T missense Het possibly damaging 0.840 0.179 phenotype 09/13/2019
38 571587 UTSW Gm8251 0.098 R7296 G1 225.01 N 1 44060916 K341* T A nonsense Het probably null 09/13/2019
39 571646 UTSW Hectd1 1.000 R7296 G1 225.01 Y 12 51785852 C913Y C T missense Het possibly damaging 0.734 phenotype 09/13/2019
40 571610 UTSW Hgf 1.000 R7296 G1 225.01 Y 5 16564843 M105K T A missense Het probably benign 0.393 phenotype 09/13/2019
41 571629 UTSW Icam1 0.136 R7296 G1 225.01 Y 9 21019015 D55A A C missense Het probably benign 0.004 phenotype 09/13/2019
42 586037 UTSW Itga2 0.000 R7296 G1 225.01 Y 13 114857394 A C splice site Het probably null phenotype 10/21/2019
43 571630 UTSW Kcnj5 0.000 R7296 G1 225.01 Y 9 32322749 L90R A C missense Het probably damaging 0.998 0.647 phenotype 09/13/2019
44 571619 UTSW Klra17 0.055 R7296 G1 225.01 Y 6 129831592 N226I T A missense Het possibly damaging 0.955 0.179 phenotype 09/13/2019
45 571656 UTSW Krt1 0.593 R7296 G1 225.01 Y 15 101850629 R33S T A missense Het unknown phenotype 09/13/2019
46 571637 UTSW L3mbtl3 1.000 R7296 G1 225.01 Y 10 26282830 D615V T A missense Het unknown 0.078 phenotype 09/13/2019
47 571593 UTSW Lrp2 1.000 R7296 G1 225.01 Y 2 69482381 Y2521F T A missense Het probably benign 0.043 phenotype 09/13/2019
48 571667 UTSW Megf10 0.578 R7296 G1 225.01 Y 18 57275753 N589I A T missense Het probably damaging 0.999 phenotype 09/13/2019
49 571594 UTSW Metap1d 0.134 R7296 G1 225.01 Y 2 71506785 G14A G C missense Het probably benign 0.046 phenotype 09/13/2019
50 571618 UTSW Mfap5 0.107 R7296 G1 225.01 Y 6 122528422 D162E T A missense Het probably benign 0.013 0.090 phenotype 09/13/2019
51 571591 UTSW Mixl1 1.000 R7296 G1 225.01 N 1 180696958 I19V T C missense Het probably benign 0.000 phenotype 09/13/2019
52 571652 UTSW Mtrr 0.000 R7296 G1 225.01 Y 13 68568860 Y411* G T nonsense Het probably null phenotype 09/13/2019
53 571653 UTSW Myh7 0.811 R7296 G1 225.01 Y 14 54990025 T318A T C missense Het probably benign 0.055 phenotype 09/13/2019
54 571589 UTSW Nbeal1 0.000 R7296 G1 225.01 Y 1 60310224 Y2348* T A nonsense Het probably null 0.971 09/13/2019
55 571657 UTSW Nlrc3 0.081 R7296 G1 225.01 Y 16 3963590 S668G T C missense Het probably damaging 0.994 phenotype 09/13/2019
56 571599 UTSW Nutm1 0.000 R7296 G1 225.01 Y 2 112250056 R505C G A missense Het probably damaging 0.975 0.647 09/13/2019
57 571596 UTSW Olfr1129 0.067 R7296 G1 225.01 Y 2 87575708 V208E T A missense Het probably damaging 0.997 phenotype 09/13/2019
58 571597 UTSW Olfr1222 0.069 R7296 G1 225.01 Y 2 89124836 R298S C A missense Het probably benign 0.030 phenotype 09/13/2019
59 571626 UTSW Olfr527 0.065 R7296 G1 225.01 Y 7 140336741 D293V A T missense Het possibly damaging 0.911 phenotype 09/13/2019
60 571600 UTSW Pcna 1.000 R7296 G1 225.01 Y 2 132252877 S54P A G missense Het probably benign 0.097 phenotype 09/13/2019
61 571668 UTSW Pde6a 0.000 R7296 G1 225.01 Y 18 61258293 T570A A G missense Het probably damaging 0.994 phenotype 09/13/2019
62 571655 UTSW Phf21b 0.000 R7296 G1 225.01 Y 15 84855717 M1K A T start codon destroyed Het probably null 0.771 09/13/2019
63 571628 UTSW Pkd1l3 0.000 R7296 G1 214.46 Y 8 109624195 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA small deletion Het probably benign phenotype 09/13/2019
64 571666 UTSW Prob1 0.131 R7296 G1 225.01 Y 18 35653299 F634S A G missense Het possibly damaging 0.533 09/13/2019
65 571635 UTSW Prss50 0.059 R7296 G1 225.01 Y 9 110861289 T167A A G missense Het probably damaging 0.997 09/13/2019
66 571604 UTSW Ptpn1 0.884 R7296 G1 225.01 Y 2 167974772 V249A T C missense Het probably damaging 0.976 phenotype 09/13/2019
67 571643 UTSW Rai1 1.000 R7296 G1 225.01 Y 11 60188673 V1188I G A missense Het probably benign 0.387 phenotype 09/13/2019
68 571670 UTSW Ric1 0.447 R7296 G1 225.01 Y 19 29584578 G A critical splice donor site 1 bp Het probably null 09/13/2019
69 571660 UTSW Robo1 1.000 R7296 G1 225.01 Y 16 72989631 Q844* C T nonsense Het probably null phenotype 09/13/2019
70 571616 UTSW Rpn1 0.959 R7296 G1 202.01 Y 6 88084637 D36G A G missense Het possibly damaging 0.458 phenotype 09/13/2019
71 571650 UTSW Serpinb1b 0.057 R7296 G1 225.01 Y 13 33093827 M348L A T missense Het probably benign 0.296 09/13/2019
72 586038 UTSW Setd4 0.000 R7296 G1 225.01 Y 16 93583942 T C intron Het probably null 10/21/2019
73 571617 UTSW Setd5 1.000 R7296 G1 225.01 Y 6 113147557 S1124A T G missense Het probably benign 0.210 phenotype 09/13/2019
74 571598 UTSW Slc35c1 0.348 R7296 G1 225.01 Y 2 92458739 V154F C A missense Het probably damaging 0.998 phenotype 09/13/2019
75 571627 UTSW Slc7a6os 0.956 R7296 G1 225.01 Y 8 106210489 S113* G T nonsense Het probably null 09/13/2019
76 571647 UTSW Syne2 0.339 R7296 G1 225.01 Y 12 76103036 D1787E T A missense Het probably benign 0.002 phenotype 09/13/2019
77 571613 UTSW Tas2r144 0.056 R7296 G1 225.01 Y 6 42215439 I38L A C missense Het probably damaging 0.999 09/13/2019
78 571644 UTSW Tepsin 0.000 R7296 G1 225.01 Y 11 120091708 T512K G T missense Het possibly damaging 0.873 09/13/2019
79 571639 UTSW Utp20 0.959 R7296 G1 225.01 Y 10 88770724 V1662A A G missense Het probably benign 0.209 phenotype 09/13/2019
80 571649 UTSW Vmn1r201 0.190 R7296 G1 225.01 Y 13 22475339 A241V C T missense Het possibly damaging 0.692 09/13/2019
81 571622 UTSW Vmn2r60 0.114 R7296 G1 225.01 Y 7 42136402 S210T T A missense Het probably benign 0.008 09/13/2019
82 571633 UTSW Wdr6 0.336 R7296 G1 225.01 Y 9 108574585 H700N G T missense Het probably damaging 1.000 phenotype 09/13/2019
83 571658 UTSW Zdhhc8 0.803 R7296 G1 225.01 Y 16 18234926 T29A T C missense Het probably benign 0.005 0.352 phenotype 09/13/2019
84 571602 UTSW Zfp335 1.000 R7296 G1 225.01 Y 2 164900132 I614T A G missense Het probably damaging 0.992 phenotype 09/13/2019
85 571661 UTSW Zfp54 0.000 R7296 G1 225.01 Y 17 21433582 S113T T A missense Het probably benign 0.109 09/13/2019
86 571638 UTSW Zfp873 0.071 R7296 G1 225.01 Y 10 82061237 C601S T A missense Het probably damaging 1.000 09/13/2019
87 586036 UTSW Zfyve26 0.000 R7296 G1 225.01 Y 12 79278372 T C intron 4430 bp Het probably null phenotype 10/21/2019
88 571603 UTSW Zmynd8 1.000 R7296 G1 225.01 Y 2 165840009 T201A T C missense Het probably damaging 0.984 phenotype 09/13/2019
[records 1 to 88 of 88]