Incidental Mutations

53 incidental mutations are currently displayed, and affect 53 genes.
10 are Possibly Damaging.
15 are Probably Damaging.
19 are Probably Benign.
6 are Probably Null.
4 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 53 of 53] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 566800 UTSW Abca14 0.000 R7298 G1 225.01 Y 7 120207883 T51S A T missense Het probably benign 0.002 06/26/2019
2 566821 UTSW Abcc1 0.123 R7298 G1 225.01 Y 16 14396472 D204G A G missense Het possibly damaging 0.894 phenotype 06/26/2019
3 566809 UTSW Acaa1b 0.000 R7298 G1 225.01 N 9 119151847 E172K C T missense Het probably benign 0.000 phenotype 06/26/2019
4 566825 UTSW Adamts5 0.265 R7298 G1 225.01 Y 16 85899918 T117I G A missense Het probably benign 0.349 0.090 phenotype 06/26/2019
5 566792 UTSW Agmat 0.105 R7298 G1 225.01 Y 4 141746964 E52G A G missense Het possibly damaging 0.904 0.101 06/26/2019
6 566807 UTSW Alg9 1.000 R7298 G1 225.01 Y 9 50779061 A121V C T missense Het probably damaging 0.967 phenotype 06/26/2019
7 566820 UTSW Atf7ip2 0.098 R7298 G1 225.01 Y 16 10209168 I100T T C missense Het possibly damaging 0.822 06/26/2019
8 586046 UTSW Calm2 0.000 R7298 G1 225.01 Y 17 87442737 T C splice site Het probably null 0.976 10/23/2019
9 566822 UTSW Cfap44 0.000 R7298 G1 225.01 Y 16 44481412 M1838L A T missense Het probably benign 0.039 phenotype 06/26/2019
10 566786 UTSW Cym 0.093 R7298 G1 225.01 Y 3 107219693 Y49H A G missense Het probably benign 0.069 0.090 06/26/2019
11 566799 UTSW Dchs1 1.000 R7298 G1 225.01 Y 7 105755131 R2735* G A nonsense Het probably null phenotype 06/26/2019
12 566790 UTSW Dnajc6 0.093 R7298 G1 225.01 Y 4 101606611 I187T T C missense Het probably benign 0.090 phenotype 06/26/2019
13 566791 UTSW Fam151a 0.000 R7298 G1 225.01 Y 4 106735528 R69L G T missense Het possibly damaging 0.795 06/26/2019
14 566793 UTSW Gm13089 0.064 R7298 G1 225.01 Y 4 143698505 D123Y C A missense Het probably benign 0.231 0.090 06/26/2019
15 566795 UTSW Gm14548 0.055 R7298 G1 150.01 N 7 3895265 I353F T A missense Het possibly damaging 0.921 06/26/2019
16 566831 UTSW Gm4779 0.103 R7298 G1 214.46 N X 101794171 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG unclassified Het probably benign 06/26/2019
17 566818 UTSW Gm9922 0.174 R7298 G1 225.01 Y 14 101729525 G97V C A missense Het unknown 06/26/2019
18 566816 UTSW Hacl1 0.000 R7298 G1 225.01 Y 14 31616486 M378K A T missense Het probably damaging 0.999 06/26/2019
19 566796 UTSW Idh2 0.000 R7298 G1 217.47 Y 7 80098331 TCCCAGG T intron Het probably benign phenotype 06/26/2019
20 566811 UTSW Ighv1-82 0.222 R7298 G1 225.01 Y 12 115952954 I6N A T missense Het possibly damaging 0.673 06/26/2019
21 566804 UTSW Kctd19 0.060 R7298 G1 225.01 Y 8 105382984 V942G A C missense Het probably benign 0.011 06/26/2019
22 566784 UTSW Lce1l 0.072 R7298 G1 225.01 Y 3 92850176 C125Y C T missense Het unknown 0.087 06/26/2019
23 566805 UTSW Mmp8 0.000 R7298 G1 225.01 Y 9 7560448 F42S T C missense Het probably damaging 0.999 phenotype 06/26/2019
24 566803 UTSW Myom2 0.099 R7298 G1 225.01 Y 8 15098411 L529P T C missense Het probably damaging 1.000 phenotype 06/26/2019
25 566823 UTSW Nectin3 0.265 R7298 G1 225.01 Y 16 46448396 Y548N A T missense Het probably damaging 1.000 0.461 phenotype 06/26/2019
26 566785 UTSW Olfml3 0.000 R7298 G1 225.01 Y 3 103735860 K402E T C missense Het probably damaging 0.993 0.186 phenotype 06/26/2019
27 566782 UTSW Olfr1255 0.094 R7298 G1 225.01 Y 2 89816521 F59S T C missense Het probably damaging 0.984 phenotype 06/26/2019
28 566797 UTSW Olfr303 0.078 R7298 G1 225.01 Y 7 86394923 T192S T A missense Het probably damaging 0.996 phenotype 06/26/2019
29 566794 UTSW Otof 0.113 R7298 G1 225.01 Y 5 30388270 I514F T A missense Het probably damaging 0.997 0.225 phenotype 06/26/2019
30 566783 UTSW Plch1 0.125 R7298 G1 225.01 Y 3 63716037 S603* G T nonsense Het probably null 0.976 phenotype 06/26/2019
31 566810 UTSW Ppa1 1.000 R7298 G1 225.01 Y 10 61666912 D171E T A missense Het probably benign 0.196 phenotype 06/26/2019
32 566826 UTSW Prss34 0.065 R7298 G1 225.01 Y 17 25299763 C240R T C missense Het probably damaging 1.000 06/26/2019
33 566802 UTSW Ptpre 0.742 R7298 G1 220.01 Y 7 135683287 D714G A G missense Het probably damaging 1.000 phenotype 06/26/2019
34 566812 UTSW Ranbp9 0.952 R7298 G1 225.01 Y 13 43480460 F157L A G missense Het probably benign 0.103 0.080 phenotype 06/26/2019
35 566801 UTSW Rbbp6 1.000 R7298 G1 225.01 Y 7 123001194 K1475E A G missense Het unknown phenotype 06/26/2019
36 566824 UTSW Retnlg 0.054 R7298 G1 225.01 Y 16 48872874 N5D A G missense Het probably benign 0.000 0.090 06/26/2019
37 566781 UTSW Rev1 0.927 R7298 G1 225.01 Y 1 38053104 T1245A T C missense Het probably damaging 0.999 phenotype 06/26/2019
38 566789 UTSW Rngtt 0.965 R7298 G1 225.01 Y 4 33362927 L360F G T missense Het probably damaging 0.996 06/26/2019
39 566819 UTSW Scrib 1.000 R7298 G1 225.01 Y 15 76064761 V447G A C missense Het probably damaging 1.000 phenotype 06/26/2019
40 566828 UTSW Slc22a6 0.058 R7298 G1 225.01 Y 19 8621320 A247E C A missense Het possibly damaging 0.488 0.179 phenotype 06/26/2019
41 566808 UTSW Slc25a20 1.000 R7298 G1 147.01 Y 9 108662144 G A start gained Het probably benign 0.090 phenotype 06/26/2019
42 586045 UTSW Spag16 0.190 R7298 G1 102.01 Y 1 69919426 T A intron Het probably null 0.976 phenotype 10/23/2019
43 566829 UTSW Stx3 1.000 R7298 G1 225.01 Y 19 11790048 W87* C T nonsense Het probably null phenotype 06/26/2019
44 566827 UTSW Syngap1 1.000 R7298 G1 225.01 Y 17 26962987 M1158K T A missense Het possibly damaging 0.854 phenotype 06/26/2019
45 566814 UTSW Tmed9 0.261 R7298 G1 225.01 Y 13 55593294 H41N C A missense Het possibly damaging 0.518 phenotype 06/26/2019
46 566817 UTSW Trav15-2-dv6-2 0.057 R7298 G1 225.01 Y 14 53649785 S54N G A missense Het probably benign 0.411 06/26/2019
47 566806 UTSW Tyk2 0.000 R7298 G1 225.01 Y 9 21108860 V1001I C T missense Het probably benign 0.352 0.090 phenotype 06/26/2019
48 566787 UTSW Ugt8a 0.738 R7298 G1 225.01 Y 3 125915416 V15A A G missense Het probably benign 0.300 0.066 phenotype 06/26/2019
49 566830 UTSW Uhrf2 0.829 R7298 G1 225.01 Y 19 30088549 E661G A G missense Het probably benign 0.000 phenotype 06/26/2019
50 566798 UTSW Vmn2r77 0.096 R7298 G1 225.01 Y 7 86800771 I75N T A missense Het probably benign 0.001 06/26/2019
51 566813 UTSW Zfp346 0.182 R7298 G1 225.01 Y 13 55130603 V258G T G missense Het probably damaging 0.974 phenotype 06/26/2019
52 566815 UTSW Zfp72 0.117 R7298 G1 225.01 Y 13 74372394 K188N T A missense Het possibly damaging 0.925 06/26/2019
53 566788 UTSW Zgrf1 0.094 R7298 G1 225.01 Y 3 127583650 S848* C A nonsense Het probably null 0.976 06/26/2019
[records 1 to 53 of 53]