Incidental Mutations

48 incidental mutations are currently displayed, and affect 48 genes.
5 are Possibly Damaging.
17 are Probably Damaging.
17 are Probably Benign.
6 are Probably Null.
0 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 48 of 48] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 566919 UTSW Adgrd1 0.000 R7300 G1 225.01 Y 5 129097347 T C critical splice donor site 2 bp Het probably null 0.948 phenotype 06/26/2019
2 566931 UTSW Atr 1.000 R7300 G1 225.01 Y 9 95865370 I235T T C missense Het probably benign 0.001 phenotype 06/26/2019
3 566922 UTSW BC024978 0.108 R7300 G1 225.01 Y 7 27201123 A176T G A missense Het probably damaging 0.997 0.092 06/26/2019
4 566912 UTSW Bpifb5 0.000 R7300 G1 225.01 Y 2 154228146 E172G A G missense Het possibly damaging 0.847 06/26/2019
5 566933 UTSW Btbd2 0.192 R7300 G1 225.01 Y 10 80644266 I420N A T missense Het probably damaging 1.000 phenotype 06/26/2019
6 566945 UTSW C330027C09Rik 0.961 R7300 G1 225.01 Y 16 49013854 K631E A G missense Het probably damaging 0.999 phenotype 06/26/2019
7 566907 UTSW Ccdc141 0.000 R7300 G1 225.01 Y 2 77014694 T1343I G A missense Het probably benign 0.001 phenotype 06/26/2019
8 566910 UTSW Cd59b 0.057 R7300 G1 225.01 Y 2 104084450 K64N A T missense Het possibly damaging 0.546 phenotype 06/26/2019
9 566934 UTSW Cd63 0.000 R7300 G1 225.01 Y 10 128912165 N144S A G missense Het probably benign 0.001 phenotype 06/26/2019
10 566903 UTSW Col4a4 0.117 R7300 G1 225.01 Y 1 82486640 R989Q C T missense Het unknown phenotype 06/26/2019
11 566916 UTSW Cyp4a31 0.061 R7300 G1 225.01 Y 4 115570271 T225A A G missense Het probably benign 0.028 0.174 06/26/2019
12 566939 UTSW Dnah1 0.000 R7300 G1 225.01 Y 14 31269841 E3068A T G missense Het probably benign 0.052 phenotype 06/26/2019
13 566915 UTSW Fpgt 0.176 R7300 G1 225.01 Y 3 155086975 V472I C T missense Het probably damaging 0.976 0.647 phenotype 06/26/2019
14 566918 UTSW Gm3147 R7300 G1 100.01 N 5 94612796 D340E A T missense Het probably benign 0.334 06/26/2019
15 566948 UTSW Gm4779 0.103 R7300 G1 214.46 N X 101794171 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG unclassified Het probably benign 06/26/2019
16 566926 UTSW Homer3 0.133 R7300 G1 225.01 Y 8 70285303 M1T T C start codon destroyed Het probably null 0.232 phenotype 06/26/2019
17 566938 UTSW Ighv1-4 0.168 R7300 G1 225.01 Y 12 114487288 I67V T C missense Het probably benign 0.238 06/26/2019
18 566920 UTSW Il17ra 0.074 R7300 G1 225.01 Y 6 120482102 D738G A G missense Het probably benign 0.004 0.064 phenotype 06/26/2019
19 566905 UTSW Il2ra 0.000 R7300 G1 225.01 N 2 11676910 T109A A G missense Het not run phenotype 06/26/2019
20 566906 UTSW Itgb6 0.929 R7300 G1 225.01 Y 2 60605306 D700G T C missense Het probably benign 0.035 phenotype 06/26/2019
21 566937 UTSW Krt31 0.000 R7300 G1 225.01 Y 11 100047786 E327G T C missense Het probably damaging 0.959 06/26/2019
22 566927 UTSW Large1 0.582 R7300 G1 225.01 Y 8 72837596 L514R A C missense Het probably damaging 1.000 phenotype 06/26/2019
23 566947 UTSW Map3k8 0.000 R7300 G1 225.01 Y 18 4349076 V81M C T missense Het probably damaging 0.978 phenotype 06/26/2019
24 566902 UTSW Mstn 0.358 R7300 G1 225.01 Y 1 53064080 S192P T C missense Het probably benign 0.130 phenotype 06/26/2019
25 566914 UTSW Olfml3 0.000 R7300 G1 225.01 Y 3 103735860 K402E T C missense Het probably damaging 0.993 0.186 phenotype 06/26/2019
26 566908 UTSW Olfr1061 0.074 R7300 G1 225.01 Y 2 86413986 E22G T C missense Het probably null 0.270 phenotype 06/26/2019
27 566946 UTSW Olfr135 0.074 R7300 G1 225.01 Y 17 38208697 T151P A C missense Het possibly damaging 0.758 phenotype 06/26/2019
28 566935 UTSW Olfr1386 0.383 R7300 G1 225.01 Y 11 49470646 T165I C T missense Het probably benign 0.004 phenotype 06/26/2019
29 566924 UTSW Olfr556 0.083 R7300 G1 225.01 Y 7 102670210 S97G A G missense Het probably benign 0.007 phenotype 06/26/2019
30 566925 UTSW Olfr60 0.065 R7300 G1 225.01 Y 7 140345355 N211K A T missense Het probably damaging 0.999 phenotype 06/26/2019
31 566928 UTSW Olfr829 0.228 R7300 G1 225.01 N 9 18857234 I194T T C missense Het not run phenotype 06/26/2019
32 566929 UTSW Pde4a 0.232 R7300 G1 225.01 Y 9 21206322 S627P T C missense Het probably damaging 0.998 0.945 phenotype 06/26/2019
33 566943 UTSW Pdxdc1 0.119 R7300 G1 225.01 Y 16 13879510 I102T A G missense Het probably damaging 0.994 06/26/2019
34 566944 UTSW Phldb2 0.000 R7300 G1 225.01 Y 16 45825562 S174P A G missense Het probably damaging 1.000 06/26/2019
35 566911 UTSW Pla2g4e 0.000 R7300 G1 225.01 Y 2 120191199 V143I C T missense Het probably damaging 1.000 phenotype 06/26/2019
36 574679 UTSW Pou4f2 0.000 R7300 G1 225.01 N 8 78436106 C T splice site 5 bp Het probably null phenotype 10/02/2019
37 566942 UTSW Ppl 0.000 R7300 G1 225.01 Y 16 5102371 V387M C T missense Het possibly damaging 0.873 phenotype 06/26/2019
38 566941 UTSW Rarg 0.826 R7300 G1 225.01 Y 15 102252417 A T critical splice donor site 2 bp Het probably null phenotype 06/26/2019
39 566923 UTSW Ryr1 1.000 R7300 G1 225.01 Y 7 29059511 Y3414C T C missense Het probably damaging 1.000 phenotype 06/26/2019
40 566904 UTSW Serpinb8 0.056 R7300 G1 225.01 Y 1 107607323 *375K T A makesense Het probably null phenotype 06/26/2019
41 566932 UTSW Sim1 1.000 R7300 G1 225.01 Y 10 50909518 H228Y C T missense Het probably benign 0.235 phenotype 06/26/2019
42 566913 UTSW Spag4 0.000 R7300 G1 225.01 Y 2 156065621 H87L A T missense Het probably benign 0.064 phenotype 06/26/2019
43 566909 UTSW Ttc17 0.738 R7300 G1 225.01 Y 2 94375134 L289Q A T missense Het probably damaging 1.000 06/26/2019
44 566940 UTSW Ubac2 0.000 R7300 G1 225.01 Y 14 121905174 L28P T C missense Het probably damaging 0.985 06/26/2019
45 566921 UTSW Vmn2r31 0.187 R7300 G1 183.01 Y 7 7384776 A599S C A missense Het possibly damaging 0.610 06/26/2019
46 566930 UTSW Vps13c 0.000 R7300 G1 225.01 Y 9 67940544 V2196A T C missense Het probably benign 0.198 0.090 phenotype 06/26/2019
47 566917 UTSW Zswim5 0.000 R7300 G1 225.01 Y 4 116975905 I612F A T missense Het probably damaging 0.998 0.117 06/26/2019
48 566936 UTSW Zzef1 0.000 R7300 G1 225.01 Y 11 72875004 H1452Q T A missense Het probably benign 0.023 06/26/2019
[records 1 to 48 of 48]