Incidental Mutations

73 incidental mutations are currently displayed, and affect 71 genes.
18 are Possibly Damaging.
19 are Probably Damaging.
28 are Probably Benign.
6 are Probably Null.
4 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 73 of 73] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 566981 UTSW Acsm3 0.000 R7301 G1 225.01 N 7 119777085 S345N G A missense Het possibly damaging 0.922 phenotype 06/26/2019
2 566971 UTSW Agk 0.613 R7301 G1 225.01 N 6 40329517 T7S A T missense Het possibly damaging 0.929 phenotype 06/26/2019
3 566973 UTSW Ankrd26 0.222 R7301 G1 225.01 N 6 118511663 E1345G T C missense Het possibly damaging 0.623 phenotype 06/26/2019
4 566978 UTSW Atp1a3 1.000 R7301 G1 225.01 N 7 24990515 Y493F T A missense Het probably benign 0.001 phenotype 06/26/2019
5 566982 UTSW Atxn2l 0.940 R7301 G1 225.01 N 7 126494211 Y791* G T nonsense Het probably null phenotype 06/26/2019
6 566974 UTSW Cacng8 0.083 R7301 G1 99.01 N 7 3415421 T363K C A missense Het probably benign 0.000 phenotype 06/26/2019
7 567017 UTSW Camkmt 0.000 R7301 G1 225.01 N 17 85431493 T216A A G missense Het probably benign 0.105 phenotype 06/26/2019
8 567016 UTSW Cd2ap 0.000 R7301 G1 225.01 N 17 42830013 R212* G A nonsense Het probably null phenotype 06/26/2019
9 566951 UTSW Cnppd1 0.000 R7301 G1 225.01 N 1 75136424 L400P A G missense Het probably damaging 0.999 06/26/2019
10 566965 UTSW Csmd2 0.161 R7301 G1 225.01 N 4 128528262 D2797E C A missense Het 0.087 06/26/2019
11 567001 UTSW Ddx24 1.000 R7301 G1 225.01 N 12 103419450 M298T A G missense Het possibly damaging 0.947 phenotype 06/26/2019
12 566959 UTSW Dpyd 0.000 R7301 G1 225.01 N 3 118899284 V359A T C missense Het possibly damaging 0.901 phenotype 06/26/2019
13 567014 UTSW Dscam 1.000 R7301 G1 225.01 N 16 97056532 T93A T C missense Het probably benign 0.008 phenotype 06/26/2019
14 566964 UTSW Eif2b3 1.000 R7301 G1 225.01 N 4 117052822 S185T T A missense Het probably benign 0.267 0.077 phenotype 06/26/2019
15 566953 UTSW Entpd2 0.106 R7301 G1 225.01 N 2 25400909 I475N T A missense Het possibly damaging 0.878 phenotype 06/26/2019
16 566976 UTSW Ercc2 1.000 R7301 G1 225.01 N 7 19394135 Q715K C A missense Het probably benign 0.093 phenotype 06/26/2019
17 567021 UTSW Fam122a 0.500 R7301 G1 225.01 N 19 24477124 H78L T A missense Het probably benign 0.005 06/26/2019
18 567022 UTSW Fam122a 0.500 R7301 G1 200.01 N 19 24477346 E4V T A missense Het probably damaging 1.000 06/26/2019
19 567013 UTSW Fam186b 0.000 R7301 G1 225.01 N 15 99278748 R754G T C missense Het probably benign 0.002 phenotype 06/26/2019
20 566979 UTSW Fcgbp 0.000 R7301 G1 225.01 N 7 28093436 V955E T A missense Het possibly damaging 0.655 06/26/2019
21 566958 UTSW Frrs1 0.258 R7301 G1 225.01 N 3 116895563 V361A T C missense Het possibly damaging 0.466 phenotype 06/26/2019
22 566961 UTSW Gabrr2 0.000 R7301 G1 225.01 N 4 33095284 M391K T A missense Het probably benign 0.017 0.075 phenotype 06/26/2019
23 566962 UTSW Gm12394 R7301 G1 141.01 N 4 42792923 N403S T C missense Het possibly damaging 0.640 06/26/2019
24 566969 UTSW Gm3409 0.068 R7301 G1 225.01 N 5 146539547 D169E T A missense Het probably benign 0.280 0.090 06/26/2019
25 567023 UTSW Gm4779 0.103 R7301 G1 214.46 N X 101794171 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG unclassified Het probably benign 06/26/2019
26 567018 UTSW Greb1l 1.000 R7301 G1 225.01 N 18 10544970 Q1433E C G missense Het probably damaging 0.999 06/26/2019
27 566992 UTSW Hal 0.076 R7301 G1 225.01 N 10 93492561 V233A T C missense Het probably benign 0.002 phenotype 06/26/2019
28 567002 UTSW Ighv1-58 R7301 G1 225.01 N 12 115312295 N74K A T missense Het probably benign 0.106 06/26/2019
29 566983 UTSW Il12rb1 0.078 R7301 G1 225.01 N 8 70813699 I229M A G missense Het possibly damaging 0.734 phenotype 06/26/2019
30 567010 UTSW Il17rd 0.000 R7301 G1 225.01 N 14 27076391 I56T T C missense Het possibly damaging 0.617 phenotype 06/26/2019
31 566972 UTSW Itpr1 0.853 R7301 G1 225.01 N 6 108542024 V2708A T C missense Het possibly damaging 0.857 phenotype 06/26/2019
32 567011 UTSW Klhl38 0.085 R7301 G1 225.01 N 15 58322980 R118W G A missense Het probably damaging 0.980 06/26/2019
33 567012 UTSW Lmf2 0.183 R7301 G1 225.01 N 15 89355530 C A start gained Het probably benign 06/26/2019
34 567009 UTSW Lrrc3b 0.000 R7301 G1 225.01 N 14 15357934 Y224C T C missense Het probably damaging 1.000 phenotype 06/26/2019
35 566999 UTSW Med1 1.000 R7301 G1 225.01 N 11 98152808 F599C A C missense Het probably benign 0.226 phenotype 06/26/2019
36 566980 UTSW Mrgprb4 0.000 R7301 G1 225.01 N 7 48198758 S141P A G missense Het probably damaging 0.990 phenotype 06/26/2019
37 566985 UTSW Mst1r 0.245 R7301 G1 225.01 N 9 107914790 A842S G T missense Het possibly damaging 0.456 phenotype 06/26/2019
38 566952 UTSW Myo3a 0.000 R7301 G1 225.01 N 2 22544466 T C critical splice donor site 2 bp Het probably null phenotype 06/26/2019
39 566967 UTSW Nos1 0.000 R7301 G1 225.01 N 5 117867905 D230V A T missense Het possibly damaging 0.895 0.738 phenotype 06/26/2019
40 566966 UTSW Nppb 0.124 R7301 G1 225.01 N 4 147986323 S52P T C missense Het probably benign 0.399 phenotype 06/26/2019
41 566984 UTSW Nqo1 0.110 R7301 G1 225.01 N 8 107392648 I99T A G missense Het probably damaging 1.000 phenotype 06/26/2019
42 566956 UTSW Olfr346 0.083 R7301 G1 225.01 N 2 36688011 M3K T A missense Het probably benign 0.000 phenotype 06/26/2019
43 566994 UTSW Olfr769 0.056 R7301 G1 225.01 N 10 129111699 H242R T C missense Het probably damaging 1.000 phenotype 06/26/2019
44 567019 UTSW Pcdha3 0.163 R7301 G1 225.01 N 18 36946924 E240K G A missense Het possibly damaging 0.564 phenotype 06/26/2019
45 566955 UTSW Plpp7 0.080 R7301 G1 225.01 N 2 32096055 F82V T G missense Het probably benign 0.000 06/26/2019
46 566970 UTSW Podxl 1.000 R7301 G1 225.01 N 6 31524436 P395T G T missense Het probably damaging 1.000 phenotype 06/26/2019
47 566957 UTSW Prr5l 0.255 R7301 G1 225.01 N 2 101717286 D298V T A missense Het probably damaging 1.000 0.173 06/26/2019
48 566968 UTSW Rad9b 1.000 R7301 G1 225.01 N 5 122352614 V13A A G missense Het possibly damaging 0.867 0.096 phenotype 06/26/2019
49 566975 UTSW Rasl2-9 0.922 R7301 G1 225.01 N 7 5125740 W64R A G missense Het probably damaging 1.000 06/26/2019
50 566998 UTSW Rilp 0.000 R7301 G1 225.01 N 11 75510116 G T unclassified Het probably benign phenotype 06/26/2019
51 567006 UTSW Ripor2 0.202 R7301 G1 225.01 N 13 24725001 I1034T T C missense Het possibly damaging 0.539 phenotype 06/26/2019
52 566989 UTSW Rtn4ip1 1.000 R7301 G1 225.01 N 10 43936020 Y338H T C missense Het probably damaging 0.960 phenotype 06/26/2019
53 566986 UTSW Shisa5 0.000 R7301 G1 149.01 N 9 109054884 G T intron Het probably benign phenotype 06/26/2019
54 566954 UTSW Slc27a4 1.000 R7301 G1 225.01 N 2 29812932 T591I C T missense Het probably null 0.989 phenotype 06/26/2019
55 567020 UTSW Snx24 0.079 R7301 G1 225.01 N 18 53340172 V63F G T missense Het probably damaging 0.999 06/26/2019
56 566995 UTSW Sptbn1 1.000 R7301 G1 225.01 N 11 30117798 Y1805* A T nonsense Het probably null phenotype 06/26/2019
57 566963 UTSW Svep1 1.000 R7301 G1 225.01 N 4 58046587 Q3515* G A nonsense Het probably null phenotype 06/26/2019
58 566960 UTSW Synpo2 1.000 R7301 G1 225.01 N 3 123114053 M538R A C missense Het probably benign 0.101 06/26/2019
59 567007 UTSW Tfap2a 1.000 R7301 G1 225.01 N 13 40721308 K276E T C missense Het probably damaging 0.999 phenotype 06/26/2019
60 566988 UTSW Tmem158 0.000 R7301 G1 225.01 N 9 123260301 S82I C A missense Het probably damaging 0.959 phenotype 06/26/2019
61 566993 UTSW Tmtc3 0.765 R7301 G1 225.01 N 10 100447474 H740N G T missense Het not run phenotype 06/26/2019
62 566996 UTSW Top3a 1.000 R7301 G1 225.01 N 11 60748148 F559I A T missense Het probably damaging 0.994 0.379 phenotype 06/26/2019
63 566990 UTSW Tysnd1 0.075 R7301 G1 161.01 N 10 61696549 P327T C A missense Het possibly damaging 0.919 phenotype 06/26/2019
64 566987 UTSW Ulk4 0.725 R7301 G1 225.01 N 9 121145059 D969V T A missense Het probably benign 0.317 phenotype 06/26/2019
65 567008 UTSW Vcan 1.000 R7301 G1 225.01 N 13 89705266 Y525F T A missense Het probably benign 0.000 phenotype 06/26/2019
66 566977 UTSW Vmn1r127 R7301 G1 225.01 N 7 21319053 F270S A G missense Het probably benign 0.356 06/26/2019
67 567003 UTSW Vmn1r204 0.069 R7301 G1 225.01 N 13 22556805 S202N G A missense Het probably damaging 1.000 06/26/2019
68 567015 UTSW Vmn2r107 0.123 R7301 G1 225.01 N 17 20345616 I64M A G missense Het probably benign 0.009 06/26/2019
69 566991 UTSW Zfp280b 0.374 R7301 G1 225.01 N 10 76038703 Q139E C G missense Het probably damaging 0.983 phenotype 06/26/2019
70 567004 UTSW Zfp322a 0.113 R7301 G1 225.01 N 13 23357143 G143V C A missense Het probably damaging 0.969 phenotype 06/26/2019
71 567005 UTSW Zfp322a 0.113 R7301 G1 225.01 N 13 23357144 G143S C T missense Het probably benign 0.222 phenotype 06/26/2019
72 567000 UTSW Zfyve26 0.000 R7301 G1 225.01 N 12 79282984 V476D A T missense Het probably benign 0.006 phenotype 06/26/2019
73 566997 UTSW Zkscan6 0.195 R7301 G1 225.01 N 11 65828225 H357L A T missense Het probably benign 0.000 0.090 06/26/2019
[records 1 to 73 of 73]