Incidental Mutations

66 incidental mutations are currently displayed, and affect 64 genes.
14 are Possibly Damaging.
14 are Probably Damaging.
29 are Probably Benign.
7 are Probably Null.
2 create premature stop codons.
5 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 66 of 66] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 567391 UTSW Abca16 0.000 R7308 G1 225.01 N 7 120423770 I43T T C missense Het probably benign 0.006 06/26/2019
2 567360 UTSW Ankar 0.065 R7308 G1 225.01 N 1 72651794 Q1175* G A nonsense Het probably null 06/26/2019
3 567369 UTSW Aqr 1.000 R7308 G1 225.01 N 2 114104062 A1366V G A missense Het possibly damaging 0.857 phenotype 06/26/2019
4 567400 UTSW Arhgap45 0.000 R7308 G1 225.01 N 10 80026558 G A critical splice donor site 1 bp Het probably null 06/26/2019
5 567388 UTSW Atf7ip 0.892 R7308 G1 225.01 N 6 136565089 M607K T A missense Het probably benign 0.008 phenotype 06/26/2019
6 567377 UTSW BC028528 0.066 R7308 G1 214.46 N 3 95888136 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT small insertion Het probably benign 06/26/2019
7 567378 UTSW BC028528 0.066 R7308 G1 217.47 N 3 95888152 TCACTGGTTCTGTGGTCACTGGTTCTGTGG TCACTGGTTCTGTGGCCACTGGTTCTGTGGTCACTGGTTCTGTGG small insertion Het probably benign 06/26/2019
8 567379 UTSW BC028528 0.066 R7308 G1 217.47 N 3 95888169 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTC small insertion Het probably benign 06/26/2019
9 567382 UTSW Bcar3 0.601 R7308 G1 225.01 N 3 122508493 V279E T A missense Het probably benign 0.005 phenotype 06/26/2019
10 567419 UTSW Cd96 0.000 R7308 G1 225.01 N 16 46071734 C T critical splice donor site 1 bp Het probably null phenotype 06/26/2019
11 567415 UTSW Cdca2 0.080 R7308 G1 225.01 N 14 67694991 P488S G A missense Het probably benign 0.000 phenotype 06/26/2019
12 567392 UTSW Col4a2 1.000 R7308 G1 225.01 N 8 11406856 T G critical splice donor site 2 bp Het probably null phenotype 06/26/2019
13 567383 UTSW Cyp4a12a 0.082 R7308 G1 225.01 N 4 115327758 R379G A G missense Het possibly damaging 0.599 06/26/2019
14 567393 UTSW Defb34 0.054 R7308 G1 225.01 N 8 19126379 S29G A G missense Het probably benign 0.317 06/26/2019
15 567408 UTSW Dnah11 0.559 R7308 G1 225.01 N 12 117995275 S2958P A G missense Het probably damaging 1.000 phenotype 06/26/2019
16 567407 UTSW Dync1h1 1.000 R7308 G1 225.01 N 12 110665162 D4431G A G missense Het possibly damaging 0.907 phenotype 06/26/2019
17 567371 UTSW Egfem1 0.000 R7308 G1 225.01 N 3 29151866 H84L A T missense Het probably benign 0.089 06/26/2019
18 567364 UTSW Enah 0.859 R7308 G1 225.01 N 1 181906385 A T critical splice donor site 2 bp Het probably null phenotype 06/26/2019
19 567359 UTSW Fam178b 0.073 R7308 G1 225.01 N 1 36659407 Q78K G T missense Het probably benign 0.000 06/26/2019
20 567399 UTSW Glb1 0.000 R7308 G1 225.01 N 9 114473863 N589S A G missense Het probably damaging 0.977 phenotype 06/26/2019
21 567370 UTSW Gm1527 0.056 R7308 G1 225.01 N 3 28902280 H132Y C T missense Het probably benign 0.016 06/26/2019
22 567363 UTSW Gm4788 0.059 R7308 G1 164.01 N 1 139754303 V185A A G missense Het possibly damaging 0.711 06/26/2019
23 567375 UTSW Gm4858 0.900 R7308 G1 225.01 N 3 93074565 T223A A G missense Het probably benign 0.000 06/26/2019
24 567412 UTSW Gm5799 0.073 R7308 G1 225.01 N 14 43543707 R22G A G missense Het possibly damaging 0.930 06/26/2019
25 567387 UTSW Grip2 0.000 R7308 G1 225.01 N 6 91778688 D617G T C missense Het possibly damaging 0.735 phenotype 06/26/2019
26 567374 UTSW Hax1 0.152 R7308 G1 225.01 N 3 89998566 D5E A T missense Het possibly damaging 0.805 phenotype 06/26/2019
27 567404 UTSW Hic1 0.345 R7308 G1 208.01 N 11 75167151 L304P A G missense Het probably damaging 0.999 phenotype 06/26/2019
28 567396 UTSW Hmox1 0.713 R7308 G1 225.01 N 8 75097019 I105N T A missense Het probably damaging 0.999 phenotype 06/26/2019
29 567376 UTSW Hormad1 0.000 R7308 G1 225.01 N 3 95562555 S38P T C missense Het probably damaging 0.994 phenotype 06/26/2019
30 567403 UTSW Hspa4 0.917 R7308 G1 225.01 N 11 53267103 S558P A G missense Het possibly damaging 0.699 phenotype 06/26/2019
31 567406 UTSW Kcnf1 0.083 R7308 G1 225.01 N 12 17174729 H497L T A missense Het probably benign 0.127 phenotype 06/26/2019
32 567411 UTSW Kcnma1 0.829 R7308 G1 225.01 N 14 23330935 D1022N C T missense Het probably damaging 0.988 phenotype 06/26/2019
33 567366 UTSW Kcnt1 0.198 R7308 G1 225.01 N 2 25900463 F479S T C missense Het possibly damaging 0.743 phenotype 06/26/2019
34 567386 UTSW Krba1 0.059 R7308 G1 225.01 N 6 48406339 V203A T C missense Het probably benign 0.036 06/26/2019
35 567362 UTSW Lct 0.000 R7308 G1 225.01 N 1 128319087 P233Q G T missense Het probably benign 0.002 phenotype 06/26/2019
36 567367 UTSW Ly75 0.000 R7308 G1 225.01 N 2 60334515 D773G T C missense Het probably benign 0.044 phenotype 06/26/2019
37 567421 UTSW Malt1 0.275 R7308 G1 225.01 N 18 65449609 T C critical splice donor site 2 bp Het probably null phenotype 06/26/2019
38 567380 UTSW Man1a2 1.000 R7308 G1 225.01 N 3 100620105 L333Q A T missense Het probably damaging 1.000 phenotype 06/26/2019
39 567395 UTSW Mtus1 0.265 R7308 G1 225.01 N 8 41082928 T584A T C missense Het probably benign 0.019 0.062 phenotype 06/26/2019
40 567424 UTSW Myof 0.000 R7308 G1 225.01 N 19 37910911 S1800R A T missense Het probably damaging 0.981 phenotype 06/26/2019
41 567373 UTSW Nbea 1.000 R7308 G1 225.01 N 3 56091031 C118W A C missense Het probably damaging 1.000 phenotype 06/26/2019
42 567394 UTSW Nsd3 0.288 R7308 G1 225.01 N 8 25640724 D35V A T missense Het probably damaging 1.000 phenotype 06/26/2019
43 567402 UTSW Olfr1386 0.224 R7308 G1 106.01 N 11 49469927 G A start gained Het probably benign phenotype 06/26/2019
44 567413 UTSW Olfr739 0.053 R7308 G1 225.01 N 14 50425265 V249I G A missense Het possibly damaging 0.572 phenotype 06/26/2019
45 567423 UTSW Pcnx3 0.000 R7308 G1 225.01 N 19 5686147 R217H C T missense Het possibly damaging 0.524 06/26/2019
46 567401 UTSW Pcsk4 0.000 R7308 G1 137.01 N 10 80323173 P462L G A missense Het probably benign 0.412 phenotype 06/26/2019
47 567418 UTSW Pdia5 0.114 R7308 G1 225.01 N 16 35456509 K96N T G missense Het probably damaging 1.000 phenotype 06/26/2019
48 567390 UTSW Pik3c2a 1.000 R7308 G1 225.01 N 7 116373839 Y707C T C missense Het probably damaging 1.000 phenotype 06/26/2019
49 567368 UTSW Ppig 0.795 R7308 G1 225.01 N 2 69749462 N447Y A T missense Het unknown 06/26/2019
50 567405 UTSW Ppp1r9b 0.000 R7308 G1 225.01 N 11 95004571 L695P T C missense Het possibly damaging 0.864 phenotype 06/26/2019
51 567372 UTSW Proser1 0.000 R7308 G1 225.01 N 3 53478704 A669V C T missense Het probably benign 0.400 phenotype 06/26/2019
52 567397 UTSW Rdx 0.000 R7308 G1 225.01 N 9 52068870 K254N A T missense Het probably damaging 0.983 phenotype 06/26/2019
53 567398 UTSW Slc35f2 0.110 R7308 G1 225.01 N 9 53798010 S95P T C missense Het probably benign 0.003 06/26/2019
54 567361 UTSW Slc4a3 0.104 R7308 G1 225.01 N 1 75557362 S1118T T A missense Het probably benign 0.002 phenotype 06/26/2019
55 567410 UTSW Slf1 0.000 R7308 G1 225.01 N 13 77051168 P698L G A missense Het probably benign 0.194 phenotype 06/26/2019
56 567422 UTSW Sptbn2 0.000 R7308 G1 225.01 N 19 4751574 E2338G A G missense Het probably benign 0.000 phenotype 06/26/2019
57 567384 UTSW Taok3 0.000 R7308 G1 225.01 N 5 117200151 Y91* T A nonsense Het probably null phenotype 06/26/2019
58 567416 UTSW Tbc1d31 0.000 R7308 G1 225.01 N 15 57952816 L649F C T missense Het probably damaging 1.000 06/26/2019
59 567385 UTSW Tmem132b 0.078 R7308 G1 225.01 N 5 125787646 I939F A T missense Het possibly damaging 0.878 06/26/2019
60 567414 UTSW Trav17 0.238 R7308 G1 225.01 N 14 53806979 Y69N T A missense Het probably benign 0.385 06/26/2019
61 567381 UTSW Trmt13 0.130 R7308 G1 225.01 N 3 116594739 D16G T C missense Het probably benign 0.089 06/26/2019
62 567365 UTSW Upf2 1.000 R7308 G1 225.01 N 2 5973518 Y398N T A missense Het unknown phenotype 06/26/2019
63 567420 UTSW Vmn1r238 0.054 R7308 G1 199.01 N 18 3122875 T180A T C missense Het probably benign 0.090 06/26/2019
64 567417 UTSW Wdyhv1 0.000 R7308 G1 225.01 N 15 58152610 V85A T C missense Het possibly damaging 0.863 phenotype 06/26/2019
65 567409 UTSW Zfp738 0.079 R7308 G1 225.01 N 13 67669553 I773N A T missense Het probably benign 0.005 06/26/2019
66 567389 UTSW Zscan4e 0.088 R7308 G1 225.01 N 7 11307153 M264K A T missense Het probably benign 0.000 06/26/2019
[records 1 to 66 of 66]