Incidental Mutations

87 incidental mutations are currently displayed, and affect 84 genes.
14 are Possibly Damaging.
25 are Probably Damaging.
30 are Probably Benign.
14 are Probably Null.
7 create premature stop codons.
5 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 87 of 87] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 567523 UTSW 2810021J22Rik 0.059 R7310 G1 225.01 N 11 58880268 Q192L A T missense Het possibly damaging 0.895 06/26/2019
2 567547 UTSW 3110002H16Rik 0.754 R7310 G1 225.01 N 18 12184915 K362E A G missense Het probably benign 0.125 phenotype 06/26/2019
3 567539 UTSW Abat 1.000 R7310 G1 225.01 N 16 8605593 R250Q G A missense Het probably null 0.012 phenotype 06/26/2019
4 567494 UTSW Abcg3 0.057 R7310 G1 225.01 N 5 104966766 F295C A C missense Het probably benign 0.014 phenotype 06/26/2019
5 567474 UTSW Abl1 0.943 R7310 G1 225.01 N 2 31800592 S708P T C missense Het possibly damaging 0.933 phenotype 06/26/2019
6 567542 UTSW Acap2 0.182 R7310 G1 225.01 N 16 31108154 Y489* A T nonsense Het probably null 06/26/2019
7 567531 UTSW Akr1c6 0.058 R7310 G1 225.01 N 13 4436355 M54L A T missense Het probably benign 0.000 phenotype 06/26/2019
8 567529 UTSW Arhgap5 1.000 R7310 G1 225.01 N 12 52542487 A T critical splice acceptor site Het probably null phenotype 06/26/2019
9 567537 UTSW Asap1 0.125 R7310 G1 225.01 N 15 64099530 A G critical splice donor site 2 bp Het probably null phenotype 06/26/2019
10 567555 UTSW Atrnl1 0.232 R7310 G1 225.01 N 19 57642424 N208Y A T missense Het possibly damaging 0.691 phenotype 06/26/2019
11 567478 UTSW BC028528 0.074 R7310 G1 214.46 N 3 95888136 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT small insertion Het probably benign 06/26/2019
12 567479 UTSW BC028528 0.074 R7310 G1 217.47 N 3 95888139 ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC small insertion Het probably benign 06/26/2019
13 567480 UTSW BC028528 0.074 R7310 G1 217.47 N 3 95888148 G GGGGTCACTGGTTCTT small insertion Het probably benign 06/26/2019
14 567481 UTSW BC028528 0.074 R7310 G1 217.47 N 3 95888173 GTTCTGTGGTCACTG GTTCTGTGGTCACTGATTCTGTGGTCACTG small insertion Het probably benign 06/26/2019
15 567522 UTSW BC049762 0.067 R7310 G1 225.01 N 11 51254647 W38G A C missense Het probably damaging 0.958 06/26/2019
16 567472 UTSW Bmi1 0.953 R7310 G1 225.01 N 2 18684419 S305P T C missense Het probably benign 0.000 phenotype 06/26/2019
17 567519 UTSW Bpifc 0.159 R7310 G1 225.01 N 10 85963027 I431F T A missense Het probably damaging 0.999 06/26/2019
18 567496 UTSW C130050O18Rik 0.057 R7310 G1 225.01 N 5 139415238 M349L A T missense Het probably benign 0.002 06/26/2019
19 567490 UTSW Cacna2d1 0.388 R7310 G1 225.01 N 5 16314916 D428V A T missense Het probably damaging 1.000 phenotype 06/26/2019
20 567528 UTSW Card14 0.093 R7310 G1 225.01 N 11 119326179 Q363P A C missense Het probably null 1.000 phenotype 06/26/2019
21 567535 UTSW Cdca2 0.099 R7310 G1 225.01 N 14 67713224 L86H A T missense Het probably damaging 0.998 phenotype 06/26/2019
22 567477 UTSW Cdh22 0.154 R7310 G1 120.01 N 2 165112294 S769* G T nonsense Het probably null phenotype 06/26/2019
23 567512 UTSW Cep164 1.000 R7310 G1 225.01 N 9 45775366 E690G T C missense Het probably damaging 1.000 phenotype 06/26/2019
24 567526 UTSW Cluh 0.309 R7310 G1 225.01 N 11 74669459 H1304R A G missense Het probably benign 0.101 phenotype 06/26/2019
25 567545 UTSW Daxx 1.000 R7310 G1 225.01 N 17 33910461 D5E C A missense Het possibly damaging 0.699 phenotype 06/26/2019
26 567469 UTSW Dnah7c 0.135 R7310 G1 225.01 N 1 46596967 M1117V A G missense Het possibly damaging 0.939 06/26/2019
27 567471 UTSW Dusp27 0.000 R7310 G1 225.01 N 1 166098731 T1104I G A missense Het possibly damaging 0.459 06/26/2019
28 567517 UTSW Entpd3 0.160 R7310 G1 225.01 N 9 120560755 T A critical splice donor site 2 bp Het probably null phenotype 06/26/2019
29 567518 UTSW Esr1 0.894 R7310 G1 225.01 N 10 4939259 A386T G A missense Het probably damaging 0.997 phenotype 06/26/2019
30 567540 UTSW Etv5 0.698 R7310 G1 225.01 N 16 22401737 P300L G A missense Het probably benign 0.351 phenotype 06/26/2019
31 567507 UTSW Exoc3l 0.221 R7310 G1 225.01 N 8 105293708 L195Q A T missense Het probably damaging 1.000 06/26/2019
32 567516 UTSW Exog 0.081 R7310 G1 225.01 N 9 119445003 L18P T C missense Het unknown phenotype 06/26/2019
33 567506 UTSW Fgfr1 1.000 R7310 G1 225.01 N 8 25562315 V219D T A missense Het probably benign 0.007 phenotype 06/26/2019
34 567491 UTSW Gm28710 0.171 R7310 G1 225.01 N 5 16870248 Y872C A G missense Het possibly damaging 0.956 06/26/2019
35 567553 UTSW Gna14 0.167 R7310 G1 225.01 N 19 16533749 Q54L A T missense Het phenotype 06/26/2019
36 567514 UTSW Gnb5 0.248 R7310 G1 225.01 N 9 75314288 L48P T C missense Het probably benign 0.000 phenotype 06/26/2019
37 567533 UTSW Gpbp1 1.000 R7310 G1 225.01 N 13 111453390 I57T A G missense Het probably benign 0.016 phenotype 06/26/2019
38 567538 UTSW Hnrnpa1 0.904 R7310 G1 225.01 N 15 103241457 D48E T A missense Het probably damaging 0.994 phenotype 06/26/2019
39 567501 UTSW Hrc 0.000 R7310 G1 225.01 N 7 45335803 L126* T A nonsense Het probably null phenotype 06/26/2019
40 567511 UTSW Hspa8 0.964 R7310 G1 157.01 N 9 40803408 D333E T G missense Het probably benign 0.085 phenotype 06/26/2019
41 567483 UTSW Igsf3 0.204 R7310 G1 225.01 N 3 101431579 V403D T A missense Het probably benign 0.007 phenotype 06/26/2019
42 567482 UTSW Itga10 0.292 R7310 G1 225.01 N 3 96648159 A143D C A missense Het probably damaging 0.997 phenotype 06/26/2019
43 567492 UTSW Kdr 1.000 R7310 G1 225.01 N 5 75944325 I1082F T A missense Het probably damaging 0.987 phenotype 06/26/2019
44 567500 UTSW Klk11 0.069 R7310 G1 225.01 N 7 43778830 I242F A T missense Het probably damaging 0.994 phenotype 06/26/2019
45 567541 UTSW Kng2 0.000 R7310 G1 225.01 N 16 22987772 T559I G A missense Het probably benign 0.001 06/26/2019
46 567532 UTSW Map1b 1.000 R7310 G1 225.01 N 13 99433655 P853S G A missense Het unknown phenotype 06/26/2019
47 567510 UTSW Mmp13 0.205 R7310 G1 225.01 N 9 7280880 I421T T C missense Het possibly damaging 0.599 phenotype 06/26/2019
48 567550 UTSW Mpeg1 0.067 R7310 G1 225.01 N 19 12462251 T358S A T missense Het probably damaging 0.993 06/26/2019
49 567484 UTSW Mttp 0.773 R7310 G1 225.01 N 3 138095022 D759G T C missense Het probably damaging 1.000 phenotype 06/26/2019
50 567486 UTSW Mup17 R7310 G1 225.01 N 4 61593692 Y115F T A missense Het possibly damaging 0.818 06/26/2019
51 567521 UTSW Myo1a 0.146 R7310 G1 225.01 N 10 127705828 A79S G T missense Het probably damaging 0.981 phenotype 06/26/2019
52 567513 UTSW Myo9a 0.000 R7310 G1 225.01 N 9 59871153 N1397K T A missense Het probably benign 0.078 phenotype 06/26/2019
53 567536 UTSW Nadk2 1.000 R7310 G1 225.01 N 15 9103381 T C critical splice donor site 2 bp Het probably null phenotype 06/26/2019
54 567495 UTSW Ncf1 0.000 R7310 G1 225.01 N 5 134221761 S402T A T missense Het probably benign 0.037 phenotype 06/26/2019
55 567544 UTSW Ndufb10 0.912 R7310 G1 225.01 N 17 24722214 D145G T C missense Het probably damaging 0.989 06/26/2019
56 567524 UTSW Nlgn2 0.000 R7310 G1 225.01 N 11 69830583 T163M G A missense Het possibly damaging 0.636 phenotype 06/26/2019
57 567548 UTSW Nol4 0.567 R7310 G1 225.01 N 18 22770744 H172Q A T missense Het 06/26/2019
58 567498 UTSW Nup205 0.960 R7310 G1 225.01 N 6 35225969 D1370E T A missense Het possibly damaging 0.784 phenotype 06/26/2019
59 567551 UTSW Olfr1447 0.074 R7310 G1 225.01 N 19 12901273 F169S A G missense Het probably damaging 1.000 phenotype 06/26/2019
60 567525 UTSW Olfr392 0.000 R7310 G1 225.01 N 11 73814286 N265K A C missense Het probably damaging 0.984 phenotype 06/26/2019
61 567503 UTSW Olfr613 0.056 R7310 G1 225.01 N 7 103552685 I300N T A missense Het probably damaging 0.998 phenotype 06/26/2019
62 567508 UTSW Pkd1l2 0.000 R7310 G1 225.01 N 8 117024034 V1746A A G missense Het probably benign 0.000 phenotype 06/26/2019
63 567487 UTSW Plin2 0.212 R7310 G1 225.01 N 4 86668391 I68F T A missense Het probably benign 0.032 phenotype 06/26/2019
64 567549 UTSW Proc 1.000 R7310 G1 225.01 N 18 32135899 M11K A T missense Het probably benign 0.025 phenotype 06/26/2019
65 567475 UTSW Rif1 1.000 R7310 G1 225.01 N 2 52105619 V950A T C missense Het probably benign 0.115 phenotype 06/26/2019
66 567473 UTSW Rnf208 0.352 R7310 G1 225.01 N 2 25243575 P94T C A missense Het probably damaging 1.000 06/26/2019
67 567489 UTSW Rundc3b 0.520 R7310 G1 225.01 N 5 8521011 Y269* A T nonsense Het probably null 06/26/2019
68 567543 UTSW Senp7 0.270 R7310 G1 225.01 N 16 56186082 V950A T C missense Het probably benign 0.176 phenotype 06/26/2019
69 567530 UTSW Sipa1l1 0.000 R7310 G1 225.01 N 12 82372495 V649A T C missense Het probably damaging 1.000 06/26/2019
70 567499 UTSW Sipa1l3 0.550 R7310 G1 225.01 N 7 29399696 H383N G T missense Het probably benign 0.000 phenotype 06/26/2019
71 567476 UTSW Slc12a5 1.000 R7310 G1 225.01 N 2 164992440 V794M G A missense Het probably damaging 0.999 phenotype 06/26/2019
72 567534 UTSW Slc7a7 1.000 R7310 G1 225.01 N 14 54379025 I200T A G missense Het probably damaging 0.994 phenotype 06/26/2019
73 567497 UTSW Spdye4b 0.000 R7310 G1 225.01 N 5 143202348 I199L A C missense Het probably damaging 0.988 06/26/2019
74 567552 UTSW Tle4 0.000 R7310 G1 225.01 N 19 14517791 H191Q A T missense Het probably benign 0.040 phenotype 06/26/2019
75 567505 UTSW Tnfsf13b 0.071 R7310 G1 225.01 N 8 10031651 S271* C A nonsense Het probably null phenotype 06/26/2019
76 567554 UTSW Tnks2 0.000 R7310 G1 225.01 N 19 36879439 V855I G A missense Het probably benign 0.121 phenotype 06/26/2019
77 567515 UTSW Trank1 0.000 R7310 G1 225.01 N 9 111367126 L1406S T C missense Het probably damaging 1.000 06/26/2019
78 567520 UTSW Trhde 0.148 R7310 G1 225.01 N 10 114800573 E243G T C missense Het probably damaging 0.987 phenotype 06/26/2019
79 567527 UTSW Trim25 0.000 R7310 G1 225.01 N 11 89015782 N448I A T missense Het probably benign 0.027 phenotype 06/26/2019
80 567546 UTSW Trim31 0.000 R7310 G1 225.01 N 17 36907302 M308K T A missense Het probably benign 0.003 phenotype 06/26/2019
81 567493 UTSW Ugt2b36 0.090 R7310 G1 225.01 N 5 87066279 V502E A T missense Het possibly damaging 0.940 06/26/2019
82 567509 UTSW Usp10 1.000 R7310 G1 225.01 N 8 119941605 D215A A C missense Het possibly damaging 0.886 phenotype 06/26/2019
83 567485 UTSW Usp33 0.838 R7310 G1 225.01 N 3 152360389 L102* T G nonsense Het probably null phenotype 06/26/2019
84 567470 UTSW Wdr12 1.000 R7310 G1 225.01 N 1 60082575 C272* A T nonsense Het probably null phenotype 06/26/2019
85 567502 UTSW Xndc1 1.000 R7310 G1 225.01 N 7 102078731 A C critical splice acceptor site Het probably null phenotype 06/26/2019
86 567504 UTSW Zkscan2 0.076 R7310 G1 225.01 N 7 123490053 I332V T C missense Het possibly damaging 0.531 06/26/2019
87 567488 UTSW Zswim5 0.000 R7310 G1 225.01 N 4 116984688 T822S A T missense Het probably benign 0.010 06/26/2019
[records 1 to 87 of 87]